| |
|
Fast Digestion (with FastDigest® restriction enzymes)
- Fast Digestion of DNA
- Prepare the reaction mixture at room temperature in the order indicated:
| Component |
Volume |
| Plasmid DNA |
Unpurified PCR product |
Genomic DNA |
| Water, nuclease-free*
| 15 µl |
17 µl |
30 µl |
10X FastDigest® buffer or 10X FastDigest® Green buffer |
2 µl |
2 µl** |
5 µl |
| DNA* |
2 µl (up to 1 µg) |
10 µl (~0.2 µg) |
10 µl (5 µg) |
| FastDigest® enzyme |
1 µl |
1 µl |
5 µl |
| Total volume |
20 µl |
30 µl |
50 µl |
- Mix gently and spin down.
- Incubate at 37°C in a heat block or water thermostat for 5 min.***
- Inactivate the enzyme (optional).***
Note* The volume of water should be corrected to keep the indicated total reaction volume. The volume of DNA can be scaled up to 10 µl or down to 0.5 µl depending on the DNA concentration.
** Only 2 µl of 10X FastDigest® buffer is required for unpurified PCR product in a 30 µl reaction volume.
*** See the Certificate of Analysis for enzyme and substrate specific incubation time and enzyme inactivation conditions.
- Reaction Set-up for Digestion of Multiple DNA Samples
- Pipette 2 µl of each DNA sample* into labeled tubes.
- Prepare a master mix for n+1 samples.
Example of master mix (for 10 samples of plasmid DNA):
| Water, nuclease-free |
(10 + 1) x 15 µl = 165 µl |
10X FastDigest® buffer or 10X FastDigest® Green buffer |
(10 + 1) x 2 µl = 22 µl |
| FastDigest® enzyme |
(10 + 1) x 1 µl = 11 µl |
- Add 18 µl of master mix into tubes containing DNA
Note* The volume of DNA can be scaled up to 10 µl or down to 0.5 µl depending on the DNA concentration. The volume of water and master mix should be corrected to keep the indicated total reaction volume.
- Double and Multiple Digestion of DNA
- FastDigest® enzymes allow simultaneous digestion of DNA with two or more enzymes in one digestion reaction.
- Use 1 µl of each enzyme and scale up the reaction conditions appropriately.
- The combined volume of all added enzymes should not exceed 1/10 of the total reaction volume.
- If enzymes require different incubation temperature, perform sequential DNA cleavage: complete the first digestion reaction at the lower temperature, add the scond enzyme and increase the digestion temperature for the second enzyme cleavage.
- Scaling up DNA Digestion Reaction
| DNA |
1 µg |
2 µg |
3 µg |
4 µg |
5 µg |
| FastDigest® enzyme |
1 µl |
2 µl |
3 µl |
4 µl |
5 µl |
10X FastDigest® buffer or 10X FastDigest® Green buffer |
2 µl |
2 µl |
3 µl |
4 µl |
5 µl |
| Total volume |
20 µl |
20 µl |
30 µl |
40 µl |
50 µl |
Conventional Digestion (with conventional restriction enzymes)
- DNA Digestion
- We recommend digesting 0.2-1.5 µg DNA with a 2-fold to 10-fold excess of enzyme in a total volume of 20 µl. A typical restriction enzyme digestion protocol is below.
- Add the following reaction components in the order indicated:
| Water, nuclease-free |
16-16.5 µl |
| 10X recommended buffer for restriction enzyme |
2 µl |
| Substrate DNA |
1 µl (~1 µg) |
| Restriction enzyme |
0.5-1 µl (5-10 u) |
| Total volume |
20 µl |
- Mix gently and spin down briefly.
- Incubate at the optimal reaction temperature for 1-16 hours.
Note
- The digestion reaction may be scaled either up or down.
- Some enzymes require additional components to obtain the stated activity. In these cases, add the required additive and adjust the volume of water appropriately.
- Digestion of PCR Products
- The most convenient option for digestion of PCR-amplified DNA is the addition of a restriction enzyme directly to the reaction tube after completion of PCR. The majority of Fermentas restriction enzymes are active in Fermentas PCR buffers.
However, digestion of PCR products in the amplification mixture is often inefficient. Therefore, PCR reaction mixture should not make more than 1/3 volume of digestion reaction mixture to avoid inhibitory effects. - Add the following reaction components in the order indicated:
| PCR reaction mixture | 10 µl (~0.1-0.5 µg of DNA) | | Water, nuclease-free | 16-17 µl | | 10X recommended buffer for restriction enzyme | 2 µl* | | Restriction enzyme | 1-2 µl (10-20 u) | | Total volume | 30 µl | * Only 2 µl of 10X reaction buffer is required for unpurified PCR product in a 30 µl reaction volume. - Mix gently and spin down briefly.
- Incubate at the optimal reaction temperature for 1-16 hours.
Note - For cloning applications, purification of PCR products prior to digestion is necessary to remove the active thermophilic DNA polymerase present in the PCR mixture. DNA polymerases may alter the ends of the cleaved DNA and reduce the yield of ligation.
- If the restriction enzyme requires special additives (e.g., SAM), reduce the amount of water appropriately.
- If cleavage of the PCR product is inefficient purify the PCR products with the GeneJET™ PCR Purification Kit (#K0702) prior to digestion.
- After digestion, gel-purify the PCR product with the GeneJET™ Gel Extraction Kit (#K0692) or Silica Bead DNA Gel Extraction Kit (#K0513) to remove short DNA fragments which compete with the insert in a ligation reaction.
- Double Digestion
- DoubleDigest™ Engine
Our DoubleDigest™ engine is a great tool to find information on buffer and reaction conditions for your double digests. Simply select two restriction enzymes required for digestion, submit the query and follow the recommendations. The DoubleDigest™ engine is continuously updated with newly released Fermentas restriction enzymes.
- Digestion of Agarose-embedded DNA
- Embed the substrate DNA in 1% low melting temperature agarose, 1 µg / 30 µl.
- Prepare ~30 µl agarose plugs with a GelSyringe® or similar agarose dispensing system.
- Equilibrate the plug in 100 µl of the appropriate 1X restriction enzyme buffer for 15 min.
- Place the plug in 100 µl of fresh 1X buffer containing the restriction enzyme (see Table "Digestion of Agarose-embedded DNA").
- Incubate at 30-37°C for mesophilic enzymes or at 50-55°C for thermophilic enzymes for 4-16 hours.
- Digestion of the Agarose-embedded DNA with I-SceI
- Immerse an agarose plug in 50-100 µl of the 1X Tango™ buffer without Mg-acetate* (supplied with the enzyme). The volume of the buffer should be sufficient to completely cover the plug.
- Add 20 u of the enzyme.
- Incubate 2 hours on ice.
- Add 1/10 volume of the 100 mM Mg-acetate solution (supplied with the enzyme).
- Incubate at 37°C for 1 hour.
Note* Diffusion of the enzyme in the absence of Mg-acetate prior to digestion is necessary, because I-SceI is unstable in the presence of Mg2+ ions.
- Partial Digestion of DNA
- Certain cloning experiments may require incomplete DNA cleavage. Such partial digestion of the DNA can be achieved by using the following conditions:
- suboptimal concentration of the restriction enzyme in the reaction mixture;
- short incubation time;
- incubation at a suboptimal temperature.
For certain targets, partial cleavage of the desired DNA site is inefficient due to site preferences of restriction enzymes.
- Inactivation of Restriction Enzymes
- Inactivation of restriction enzymes following a digestion reaction is often required for downstream applications.
Thermal inactivation is a convenient method used to terminate enzyme activity. The majority of restriction enzymes can be heat-inactivated at 65°C or 80°C in 20 min. Information on susceptibility of Fermentas restriction enzymes to thermal inactivation is listed in the Table "Reaction Conditions for Restriction Enzymes", as well as in product descriptions and Certificates of Analysis. All known restriction enzymes with exception of BfiI require Mg2+ for DNA cleavage. Thus, addition of EDTA (20 mM final concentration) to the reaction mixture is an alternative method that can be used to halt digestion. EDTA is generally not compatible with most of downstream applications, therefore purification of the digested DNA using GeneJET™ PCR Purification Kit (#K0702) or by chloroform extraction is recommended.
- Dilution of Restriction Enzymes
- Dilution Buffer for Restriction Enzymes (#B19) is available from Fermentas for applications that require diluted enzymes.
Enzymes diluted in this buffer retain 50-100% activity after storage for one month at -20°C.
PCR Protocols
- Guidelines for Preventing Contamination of PCR
- During PCR more than 10 million copies of a template DNA are generated. Therefore, care must be taken to avoid contamination with other templates and amplicons that may be present in the laboratory environment. General recommendations to lower the risk of contamination are the following:
- Prepare your DNA sample, set up the PCR mixture, perform thermal cycling and analyze PCR products in separate areas.
- Set up mixtures for PCR in a laminar flow cabinet equipped with an UV lamp.
- Wear fresh gloves for DNA purification and reaction set up.
- Use containers dedicated for PCR. Use positive displacement pipettes, or use pipette tips with aerosol filters to prepare DNA samples and set up PCR.
- Use certified reagents, including high quality water (e.g., Water, nuclease-free).
- Always perform No-Template-Control (NTC) reactions to check for the absence of contamination.
For detailed instructions for the set-up of a PCR laboratory and its maintenance, refer to PCR Methods and Applications, 3, 2, S1-S14, 1993. PCR frequently is contaminated by amplicons from previous PCR held in the same room. One of the most popular and efficient methods for prevention of carryover contamination is a use of uracil DNA glycosylase* (UDG) (1). A part or all of the dTTP in the PCR reaction is substituted by dUTP and therefore all PCR products generated in your working environment contain dUTP. Prior to each PCR, short incubation with UDG eliminates such contaminating amplicons carried over from the previous PCR. Incorporation of dUTP does not affect the intensity of ethidium bromide staining or the electrophoretic mobility of the PCR product, therefore the reactions can be analyzed by standard agarose gel electrophoresis. Taq DNA polymerase and all other non-proofreading polymerases will incorporate dUTP into a PCR product, but proofreading polymerases or enzyme mixes containing such proofreading polymerases (e.g, Fermentas DreamTaq™ DNA Polymerase, High Fidelity Enzyme Mix or the Long PCR Enzyme Mix), do not incorporate dUTP or may incorporate with much less efficiency. * Use of such enzyme in certain territories may be covered by patents and may require a license.
Reference - Longo, M.C., et al., Use of uracil DNA glycosylase to control carry-over contamination in polymerase chain reactions, Gene 93, 125-8, 1990.
- Guidelines for Primer Design
- Use the REviewer™ primer design software or follow general recommendations for PCR primer design below:
- PCR primers are generally 15-30 nucleotides long.
- Optimal GC content of the primer is 40-60%. Ideally, C and G nucleotides should be distributed uniformly along the primer.
- Prefer one or two G or C at the 3'-end of the primer, but avoid placing more than three G or C nucleotides at the 3'-end to lower the risk of nonspecific priming.
- Avoid primer self-complementarities, complementarities between the primers and direct repeats in a primer to prevent hairpin formation and primer dimerization.
- Check for possible complementary sites between primers and template DNA.
- When designing degenerate primers, place at least 3 conservative nucleotides at the 3'-end.
- Differences in melting temperatures (Tm) of the two primers should not exceed 5°C for conventional PCR.
Estimation of Primer Melting Temperature
- For primers containing less than 25 nucleotides, the approx. melting temperature (Tm) can be calculated using the following equation:
Tm = 4 (G + C) + 2 (A + T), where G, C, A, T – number of respective nucleotides in the primer.
- If the primer contains more than 25 nucleotides specialized computer programs e.g, REviewer™ are recommended to account for interactions of adjacent bases, effect of salt concentration, etc.
- For calculation of primer melting temperature only consider nucleotides homologous to the template.
Considerations for Subsequent Cloning of PCR Products
- Components of the Reaction Mixture
- Template DNA
Optimal amounts of template DNA in the 50 µl reaction volume are in the 0.01-1 ng range for both plasmid and phage DNA, and in the 0.1-1 µg range for genomic DNA. Higher amounts of template increase the risk of generation of nonspecific PCR products. Lower amounts of template reduce the accuracy of the amplification. All routine DNA purification methods are suitable for template preparation e.g., Genomic DNA Purification Kit (#K0512), GeneJET™ Plasmid Miniprep Kit (#K0502). Trace amounts of certain agents used for DNA purification, such as phenol, EDTA and proteinase K, can inhibit thermostable DNA polymerases. Ethanol precipitation and repeated washes of the DNA pellet with 70% ethanol normally remove trace contaminants from DNA samples.
Primers
The recommended concentration range of primers is 0.1-1 µM. Too high primer concentrations increase the probability of mispriming and thereby appearance of nonspecific PCR products. For degenerate primers and primers used for long PCR higher primer concentrations in the range of 0.3-1 µM are often favorable. Therefore start optimization from standard concentrations and increase if necessary.
Mg2+ Concentration Mg2+ in general stabilizes primer-template complexes. PCR buffers for Taq DNA Polymerase are supplemented with Mg2+, while in PCR with Pfu DNA Polymerase MgSO4 is a preferable component. Due to the binding of Mg2+ to dNTPs, primers and DNA templates, Mg2+ concentration needs to be optimized for maximal PCR yield. The recommended concentration range is 1-4 mM. If the Mg2+ concentration is too low, the yield of PCR product could be reduced. On the contrary, non-specific PCR products may appear and the PCR fidelity may be reduced if the Mg2+ concentration is too high. If DNA samples contain EDTA or other metal chelators, the Mg2+ ion concentration in the PCR mixture should be increased accordingly (1 molecule of EDTA binds 1 molecule of Mg2+(1)).
Recommended Mg2+ concentrations:
- Taq DNA Polymerase at Fermentas is supplied with two buffers: Taq buffer with KCl and Taq buffer with (NH4)2SO4. K+ stabilizes primer annealing whereas NH4+ has a destabilizing effect especially on weak hydrogen bonds between mismatched primer-template base pairs. Therefore for standard PCR with Taq DNA Polymerase and 0.2 mM dNTPs the recommended MgCl2 concentrations are in general lower 1.5±0.25 mM when using Taq buffer with KCl compared to 2.0±0.5 mM when using Taq buffer with (NH4)2SO4. Due to antagonistic effects of NH4+ and Mg2+, Taq buffer with (NH4)2SO4 offers higher primer specificity in a broad range of magnesium concentrations at variety of annealing temperatures.
- For standard PCR with Pfu DNA Polymerase, 2 mM MgSO4 is recommended.
Volumes of 25 mM MgCl2 or 25 mM MgSO4 solutions required to reach a specific concentration of magnesium ions in the 50 µl reaction volume:
| Final concentration, mM |
1.0 |
1.25 |
1.5 |
1.75 |
2.0 |
2.5 |
3.0 |
4.0 |
| Volume of 25 mM MgCl2 or MgSO4, µl |
2 |
2.5 |
3 |
3.5 |
4 |
5 |
6 |
8 |
dNTPs The recommended concentration of each dNTP is 0.2 mM. In certain PCR applications higher dNTP concentrations are required. Due to the binding of Mg2+ to dNTPs, Mg2+ concentration needs to be adjusted accordingly. It is essential to have equal concentrations of all four nucleotides (dATP, dCTP, dGTP and dTTP). If the nucleotide concentrations are not balanced, the PCR error rate may dramatically increase. Fermentas PureExtreme® dNTP Mixes contain either 2 mM or 10 mM, or 25 mM of each nucleotide. The concentrations of all four dNTPs are perfectly balanced to provide fidelity and to increase the yield of PCR products. To achieve 0.2 mM concentration of each dNTP in the PCR mixture, use the following volumes of dNTP Mixes:
| Volume of PCR mixture |
dNTP Mix, 2 mM each (#R0241) |
dNTP Mix, 10 mM each (#R0191) |
dNTP Mix, 25 mM each (#R1121) |
| 50 µl |
5 µl | 1 µl |
0.4 µl |
| 25 µl |
2.5 µl | 0.5 µl |
0.2 µl |
| 20 µl |
2 µl | 0.4 µl |
0.16 µl |
To prepare 1 ml of working solutions of dNTPs (dNTP Mixes) from individual 100 mM dNTPs or dNTP Set, use the following volumes of reagents:
| Component |
dNTP Mix, 2 mM each (#R0241) |
dNTP Mix, 10 mM each (#R0191) |
dNTP Mix, 25 mM each (#R1121) |
| dATP, 100 mM
| 20 µl |
100 µl |
250 µl |
| dTTP, 100 mM |
20 µl |
100 µl |
250 µl |
| dGTP, 100 mM |
20 µl |
100 µl |
250 µl |
| dCTP, 100 mM |
20 µl |
100 µl |
250 µl |
| Water, nuclease-free |
920 µl |
600 µl |
- |
| Total volume |
1 ml |
1 ml |
1 ml |
Thermostabile DNA Polymerases
Taq DNA Polymerase. Taq DNA polymerase is the most commonly used enzyme for PCR. It is suitable for most amplifcation reactions that do not require high fidelity enzyme or PCR products longer than 3 kb.
Normally, 1-1.5 u of Taq DNA Polymerase are recommended for a 50 µl volume of a PCR mixture. Nonspecific PCR products may appear at higher concentrations of the polymerase. However, it may be necessary to increase the amount of Taq DNA Polymerase to 2-3 u, if the PCR mixture contains inhibitors, for instance, due to contamination of the template DNA.
Taq DNA polymerase, if PCR is assembled at room temperature, exhibits low but noticeable activity during the reaction set-up. As a result, non-specific priming events, such as mispriming or formation of primer dimers, which occur at ambient temperatures, will lead to generation of nonspecific amplification products during PCR. Therefore, PCR reaction set-up should always be performed on ice.
DreamTaq™ DNA Polymerase. DreamTaq™ DNA Polymerase is an enhanced Taq DNA polymerase optimized for all standard PCR applications. It ensures higher sensitivity, longer PCR products and higher yields compared to conventional Taq DNA Polymerase. DreamTaq™ DNA Polymerase uses the same reaction set-up and cycling conditions as conventional Taq DNA Polymerase. An optimization of reaction conditions is generally not required. It is supplied with optimized DreamTaq™ buffer, which includes 20 mM MgCl2. DreamTaq™ DNA Polymerase generates PCR products with 3’-dA overhangs. PCR with DreamTaq™ DNA Polymerase is inhibited by dUTP, but the enzyme can incorporate modified nucleotides.
Hot Start Taq DNA Polymerases. Hot start PCR uses enzymes, which have no activity at room temperature and are activated only at high temperatures during PCR cycling (e.g. TrueStart™ Hot Start Taq DNA Polymerase or Maxima® Hot Start Taq DNA Polymerase). In hot start PCR non-specific amplification is reduced and target yield is increased. Using hot start DNA polymerases, PCR can be set-up at room temperature. TrueStart™ Hot Start Taq DNA polymerase has very short activation time (1 min) and can be used without changing of regular PCR cycling protocol. Maxima® Hot Start Taq DNA Polymerase is activated in 4 min. Pfu DNA Polymerase. Pfu DNA Polymerase is a thermostable DNA polymerase with proofreading activity. It is one of the highest fidelity enzymes among thermostable DNA polymerases and is widely used in applications which require high fidelity amplification, e.g. cloning and expression. Normally, 1.25-2.5 u of Pfu DNA Polymerase are used in a 50 µl volume of PCR mixture. The actual amount of enzyme required for optimal PCR yield and fidelity depends on the target to be amplified and on the presence of inhibitors in the PCR mixture. Pfu DNA polymerase is a slower enzyme than Taq DNA polymerase and it requires an elongation time of 2 min/kb. Also, Pfu DNA polymerase often requires more PCR cycles to produce sufficient amount of PCR product. Due to the intrinsic 3'=>5' exonuclease activity Pfu DNA polymerase should always be the last component added to the reaction mixture to avoid degradation of primers. It is also recommended to use longer PCR primers. Alternatively, phosphorothioate primers (exo- resistant primers) can be used to avoid primer degradation by Pfu DNA Polymerase (2). PCR Enzyme Mixes. Long PCR Enzyme Mix and High Fidelity Enzyme Mix are blends of Taq DNA Polymerase and a thermostable DNA polymerase with a proofreading activity. The two enzymes synergistically generate long PCR products in greater yields and higher fidelity than Taq DNA Polymerase alone. The Long PCR Enzyme Mix is also used for efficient amplification of GC-rich DNA regions. Normally, 1.25-2.5 u of Enzyme Mix are used in a 50 µl volume of PCR mixture. Due to the 3'=>5' exonuclease activity of proofreading enzyme Enzyme Mixes should always be last components added to the reaction mixture to avoid degradation of primers. It is also recommended to use longer PCR primers. Alternatively, phosphorothioate primers (exo-resistant primers) can be used to avoid primer degradation by enzyme mixes. PCR Master Mixes. Thermostable DNA polymerases can be provided in a Master Mix format, a ready to use 2X concentrated solution, which includes DNA polymerase together with a PCR buffer and nucleotides. The Master mix is the most convenient and cost effective product for routine or high throughput PCR, where time for setting up a reaction and reproducibility of results are most important factors. Fermentas offers two PCR Master Mixes. The PCR Master Mix (2X) contains Taq DNA polymerase and is suitable for routine PCR. The PyroStart™ Fast PCR Master Mix (2X) contains a hot start Taq DNA polymerase and is formulated to work in fast thermal cycling conditions to reduce time not only dedicated to PCR set-up, but also to PCR cycling. PCR of less than 1 kb target can be completed in 25 min using this product.
References
- David, H., Modern Analytical Chemistry, Mc Graw Hill, 315, 2000.
- Skerra, A., Phosphorothioate primers improve the amplification of DNA sequences by DNA polymerases with proofreading activity, Nucleic Acids Res., 20, 3551-3554, 1992.
- Cycling Parameters
- Amplification parameters greatly depend on the template, primers and parameters of the thermal cycler used. At Fermentas, functional PCR tests are performed on the GeneAmp® PCR System 9700 (Applied Biosystems) or Mastercycler® ep gradient S (Eppendorf).
Initial DNA Denaturation. It is essential to completely denature the template DNA at the beginning of PCR to ensure efficient utilization of the template during the first amplification cycle. If GC content of the template is 50% or less, an initial 1-3 min denaturation at 95°C is sufficient. For GC-rich templates, this step has to be prolonged to 10 min. If longer initial denaturation step is required, or DNA is denatured at a higher temperature, the Taq DNA Polymerase can be added after DNA is denatured to avoid a decrease in its activity. Pfu DNA Polymerase can withstand a prolonged initial denaturation step due to its higher thermostability.
Hot Start PCR. Hot start PCR uses Taq DNA polymerases which are inactive at room temperature and are activated during the initial DNA denaturation/ enzyme activation step at 95°C. TrueStart™ Hot Start Taq DNA polymerase has a very short activation time (1 min) and can be used without changing the regular PCR cyling protocol. Maxima® Hot Start Taq DNA Polymerase activates in 4 min, therefore the initial denaturation step should be set to 4 min.
Denaturation. Normally 0.5-2 min DNA denaturation at 94-95°C per cycle is sufficient. For GC-rich DNA templates, this step could be prolonged to 3-4 min. DNA denaturation can also be enhanced by the addition of either 10-15% glycerol or 10% DMSO, 5% formamide or 1-1.5 M betaine. The melting temperature of the primer-template complex decreases significantly in the presence of these reagents. Therefore, the annealing temperature has to be adjusted accordingly. Also, 10% DMSO and 5% formamide inhibit DNA polymerases by 50%. Thus, the amount of the enzyme should be increased, if these additives are used. Substitution of dGTP with 7-deaza-dGTP also can be used to decrease the melting temperature of PCR products.
Primer Annealing. Annealing temperature should be 5°C lower than the lowest primer-template melting temperature (Tm). Annealing for 0.5-2 min is normally sufficient. If nonspecific PCR products appear the annealing temperature should be optimized stepwise in 1-2°C increments. When additives are used which change the melting temperature of the primer-template complex (glycerol, DMSO, formamide and betaine), the annealing temperature also has to be adjusted.
Touchdown PCR. Some experimental objectives may require PCR with a primer pair, which in conventional cycling protocol would generate unspecific products. In such cases a modification of conventional PCR, the touchdown PCR, may help to reduce the nonspecific amplification. In early PCR cycles an annealing temperature higher than the primer melting temperature is chosen and is decreased by 1°C every cycle or every second cycle until the desired or "touchdown" annealing temperature is reached. For the remaining cycles this touchdown temperature is used. By this the desired product is usually enriched over non-specific products.
Extension. The rate of DNA synthesis by Taq DNA Polymerase and Pfu DNA Polymerase is highest at 70-75°C. As a general rule, the extension step with Taq DNA Polymerase is 1 min at 72°C for PCR products up to 2 kb. For larger products, the extension time is prolonged by 1 min/kb. Since Pfu DNA Polymerase exhibits lower extension rate, an extension step of 2 min/kb at 72°C is recommended. Long PCR. For amplification of longer templates (>6 kb) a reduction of the extension temperature to 68°C is preferable to avoid enzyme loss during prolonged extension times.
Number of Cycles. The number of cycles may vary depending on the amount of template DNA in the PCR mixture and the expected yield of PCR product. If less than 10 copies of the template are present in the reaction, about 40 cycles are required. With higher template amounts 25-35 cycles are sufficient.
Final Extension. After the last cycle, it is recommended to incubate the PCR mixture at 72°C for additional 5-15 min to fill-in the protruding ends of reaction products. If PCR product is to be cloned into TA vectors (for instance, using InsTAclone™ PCR Cloning Kit), the final extension step may be prolonged to 30 min to ensure the highest efficiency of 3'-dA tailing of PCR product. If PCR product generated with Taq DNA polymerase will be used for cloning using CloneJET™ PCR Cloning Kit the final extension step can be omitted.
Fast PCR To drastically shorten the overall PCR cycling time Fermentas offers a specific formulation of hot start Taq DNA polymerase in convenient form of a master mix – PyroStart™ Fast PCR Master Mix (2x). In Fast PCR the duration of all PCR cycling steps is reduced. The Primer Annealing and Extension steps are combined in a single step of 25 s/kb with the possibility to optimize time down to 0 s. The Initial DNA Denaturation step is reduced to 60 s and the Final Extension step to 10 s. Therefore the overall time of a PCR <1 kb may be reduced to as little as 25 min compared to 2 h for conventional cycling protocols without compromising the yield, specificity and reproducibility.
- Standard PCR (reaction set up)
- The provided set-up is suitable for following Fermentas enzymes: DreamTaq™ DNA Polymerase, DreamTaq™ Green DNA Polymerase, Taq DNA Polymerase, recombinant and Taq DNA Polymerase, native.
Master Mix. To prepare several parallel reactions and to minimize the possibility of pipetting errors, prepare a PCR master mix by adding water, buffer, dNTPs, primers and Taq DNA polymerase. Prepare enough master mix for the number of reactions and add one extra to compensate for pipetting errors. Aliquot the master mix into individual PCR tubes and add template DNA.
- Gently vortex and briefly centrifuge all solutions after thawing.
- Place a thin-walled PCR tube on ice and add the following components for each 50 µl reaction:
| 10X Taq buffer |
5 µl |
| dNTP Mix, 2 mM each |
5 µl (0.2 mM of each) |
| Forward primer |
0.1-1 µM |
| Reverse primer |
0.1-1 µM |
| 25 mM MgCl2* |
1-4 mM |
| Template DNA |
10 pg – 1 µg |
| Taq DNA Polymerase |
1.25 u |
| Water, nuclease-free |
to 50 µl |
| Total volume |
50 µl |
* Optional for PCR with DreamTaq™ DNA Polymerase, because the provided 10X DreamTaq™ buffer contains 20 mM MgCl2.
- Gently vortex the samples and spin down to collect drops.
Note
- When using thermal cyclers without a heated lid, overlay the reaction mixture with 25 µl of mineral oil.
- Reaction volumes can be scaled up or down as long as the final concentrations of the reaction components remain the same.
Recommended thermal cycling conditions:
| Step |
Temperature, °C |
Time, min |
Number of Cycles |
| Initial Denaturation |
95 |
1-3 |
1 |
| Denaturation |
95 |
0.5 |
25-40 |
| Annealing |
Tm-5 |
0.5 |
| Extension |
72 |
1 min/kb |
| Final Extension |
72 |
5-15 |
1 |
- Hot Start PCR with TrueStart™ Hot Start Taq DNA Polymerase (reaction set up)
- Hot start PCR does not require reaction set up on ice. It involves an enzyme activation step in the cycling protocol.
Master Mix. To prepare several parallel reactions and to minimize the possibility of pipetting errors, prepare a PCR master mix by adding water, buffer, dNTPs, primers and Taq DNA polymerase. Prepare enough master mix for the number of reactions and add one extra to compensate for pipetting errors. Aliquot the master mix into individual PCR tubes and add template DNA. Keep all reaction components on ice. Reaction set up can be performed at room temperature.
- Gently vortex and briefly centrifuge all solutions after thawing.
- Place a thin-walled PCR tube on ice and add the following components for each 50 µl reaction:
| 10X TrueStart™ Hot Start Taq buffer | 5 µl |
| dNTP Mix, 2 mM each | 5 µl (0.2 mM of each) |
| 25 mM MgCl2 | 1.2 µl |
| Forward primer | 0.1-1 µM |
| Reverse primer | 0.1-1 µM |
| TrueStart™ Hot Start Taq DNA Polymerase | 0.25-2 u |
| Water, nuclease-free | to 50 µl |
| Total volume | 50 µl |
- Gently vortex the samples and spin down to collect drops.
Note - When using thermal cyclers without a heated lid, overlay the reaction mixture with 25 µl mineral oil.
- Reaction volumes can be scaled up or down as long as the final concentrations of the reaction components remain the same.
Recommended thermal cycling conditions: | Step | Temperature, °C | Time, min | Number of Cycles | | Initial Denaturation/Enzyme Activation | 95 | 1-2 | 1 | | Denaturation | 95 | 0.5-1 | 30 | | Annealing | Tm-5 | 0.5-1 | | Extension | 72 | 1 min/kb | | Final Extension | 72 | 5-15 | 1 |
- Hot Start PCR with Maxima® Hot Start Taq DNA Polymerase (reaction set up)
- Hot start PCR does not require reaction set up on ice. It involves an enzyme activation step in the cycling protocol.
Master Mix. To prepare several parallel reactions and to minimize the possibility of pipetting errors, prepare a PCR master mix by adding water, buffer, dNTPs, primers and Taq DNA polymerase. Prepare enough master mix for the number of reactions and add one extra to compensate for pipetting errors. Aliquot the master mix into individual PCR tubes and add template DNA. Keep all reaction components on ice. Reaction set up can be performed at room temperature. - Gently vortex and briefly centrifuge all solutions after thawing.
- Place a thin-walled PCR tube on ice and add the following components for each 50 µl reaction:
| 10X Maxima® Hot Start Taq buffer | 5 µl | | dNTP Mix, 2 mM each | 5 µl (0.2 mM of each) | | Forward primer | 0.1-1 µM | | Reverse primer | 0.1-1 µM | | 25 mM MgCl2 | 1-4 mM | | Template DNA | 10 pg – 1 µg | | Maxima® Hot Start Taq DNA Polymerase | 1.25-2 u | | Water, nuclease-free | to 50 µl | | Total volume | 50 µl |
- Gently vortex the samples and spin down to collect drops.
Note - When using thermal cyclers without a heated lid, overlay the reaction mixture with 25 µl mineral oil.
- Reaction volumes can be scaled up or down as long as the final concentrations of the reaction components remain the same.
Recommended thermal cycling conditions: | Step | Temperature, °C | Time, min | Number of Cycles | | Initial Denaturation/Enzyme Activation | 95 | 4 | 1 | | Denaturation | 95 | 0.5-1 | 25-40 | | Annealing | Tm-5 | 0.5-1 | | Extension | 72 | 1 min/kb | | Final Extension | 72 | 5-15 | 1 |
- High Fidelity PCR (reaction set up)
- Pfu DNA Polymerase is high fidelity DNA polymerase which has several differences from Taq DNA polymerase. Pfu DNA polymerase should always be the last component added to the reaction mixture to avoid degradation of primers due to its intrinsic 3'=>5' exonuclease activity. Due to this feature, it is also recommended to use longer PCR primers. Pfu DNA polymerase is slower enzyme therefore for elongation step it is necessary to allow 2 min/kb. Also, Pfu DNA polymerase often requires more PCR cycles to produce sufficient amount of PCR product.
Master Mix. To prepare several parallel reactions and to minimize the possibility of pipetting errors, prepare a PCR master mix by adding water, buffer, dNTPs, and primers. Prepare enough master mix for the number of reactions and add one extra to compensate for pipetting errors. Aliquot the master mix into individual PCR tubes and add template DNA
- Gently vortex and briefly centrifuge all solutions after thawing.
- Place a thin-walled PCR tube on ice and add the following components for each 50 µl reaction:
| 10X Pfu buffer with 20 mM MgSO4 |
5 µl |
| dNTP Mix, 2 mM each |
5 µl (0.2 mM of each) |
| Forward primer |
0.1-1 µM |
| Reverse primer |
0.1-1 µM |
| Template DNA |
50 pg – 1 µg |
| Pfu DNA Polymerase |
1.25 u |
| Water, nuclease-free |
to 50 µl |
| Total volume |
50 µl |
- Gently vortex the samples and spin down to collect drops.
Note
- When using thermal cyclers without a heated lid, overlay the reaction mixture with 25 µl mineral oil.
- Reaction volumes can be scaled up or down as long as the final concentrations of the reaction components remain the same.
Recommended thermal cycling conditions:
| Step |
Temperature, °C |
Time, min | Number of Cycles |
| Initial Denaturation |
95 |
1-3 |
1 |
| Denaturation |
95 |
0.5 |
35-40 |
| Annealing |
Tm-5 |
0.5 |
| Extension |
72 |
2 min/kb |
| Final Extension |
72 |
5-15 |
1 |
- Long Range PCR (reaction set up)
- Fermentas offers two products suitable for long range PCR: Long PCR Enzyme Mix and High Fidelity PCR Enzyme Mix. The enzyme mixes contain Taq DNA polymerase and a thermostabile high fidelity DNA polymerase with proofreading activity. Due to the intrinsic 3'=>5' exonuclease activity of the high fidelity DNA polymerase, the enzyme mix should always be the last component added to the reaction mixture to avoid degradation of primers. Additionally, use of longer PCR primers (26-36 nt) is recommended.
This protocol is provided for Long PCR Enzyme Mix.
Master Mix. To prepare several parallel reactions and to minimize the possibility of pipetting errors, prepare a PCR master mix by adding water, buffer, dNTPs, and primers. Prepare enough master mix for the number of reactions and add one extra to compensate for pipetting errors. Aliquot the master mix into individual PCR tubes and add template DNA.
- Gently vortex and briefly centrifuge all solutions after thawing.
- Place a thin-walled PCR tube on ice and add the following components for each 50 µl reaction:
| Components |
PCR <30 kb |
PCR >30 kb and GC-rich PCR |
| 10X long PCR buffer with 15 mM MgCl2 |
5 µl |
5 µl |
| dNTP Mix, 2 mM each |
5 µl (0.2 mM of each) |
5 µl (0.2 mM of each) |
| Forward primer |
0.3-1 µM |
0.3-1 µM |
| Reverse primer |
0.3-1 µM |
0.3-1 µM |
| Template DNA |
10 pg – 1 µg |
1 ng – 1 µg |
| DMSO |
– |
2 µl (4%) |
| Long PCR Enzyme Mix |
1.25-2.5 u |
2.5 u |
| Water, nuclease-free |
to 50 µl |
to 50 µl |
- Gently vortex the samples and spin down to collect drops.
NoteWhen using thermal cyclers without a heated lid, overlay the reaction mixture with 25 µl mineral oil.
Reaction volumes can be scaled up or down as long as the final concentrations of the reaction components remain the same.
Recommended thermal cycling conditions:
| Step |
Temperature, °C |
Time |
Number of Cycles |
| Initial Denaturation |
94 |
1-3 |
1 |
| Denaturation |
94-96 |
20 s |
10 |
| Annealing |
Tm-5 |
30 s |
| Extension |
68 |
60 s/kb |
| Denaturation |
94 |
20 s/kb |
15-25 |
| Annealing |
Tm-5 |
30 s/kb |
| Extension |
68 |
60 s/kb+5 s/cycle* |
| Final Extension |
68 |
10 min |
1 |
* Recommended extensions to the elongation time:
| PCR fragment length, kb |
10 |
15 |
20 |
25 |
30 |
35 |
40 |
45 |
| Auto-extension per cycle, s |
5 |
5 |
10 |
10 |
15 |
15 |
20 |
20 |
RT-PCR Protocols
- Guidelines to Avoid RNase Contamination
- RNA purity and integrity is essential for synthesis of full-length cDNA, which results in high quality RT-PCR products. Therefore, RNase contamination is always a concern when working with RNA. The RNA quality can be affected by RNase A, which is a highly stable contaminant of any laboratory environment. All components of the kit have been rigorously tested to ensure that they are RNase free. To prevent contamination both the laboratory environment and all prepared solutions must be free of RNases.
- DEPC-treat all tubes and pipette tips to be used in the cDNA synthesis or use certified nuclease-free labware.
- Use pipettes dedicated for RNA work.
- Wear gloves when handling RNA and all reagents, as skin is an common source of RNases. Change gloves frequently.
- Use certified reagents, including high quality water (e.g., nuclease-free or DEPC-treated Water).
- Use an RNase inhibitor, such as RiboLock™ RNase Inhibitor, to protect template RNA.
- Always assess the integrity of RNA prior to cDNA synthesis. For example, if sharp bands of both the human 18S rRNA (runs at approx. 1.9 kb) and the 28S rRNA (runs at approx. 5 kb) are formed during denaturing agarose gel electrophoresis of total RNA, the mRNA in the sample is considered to be intact.
- Components of the Reaction Mixture
- Template RNA
Total cellular RNA isolated by standard methods can be successfully used with Fermentas reverse transcriptases or the kits for first strand cDNA synthesis. The purified RNA has to be free of salts, metal ions, ethanol and phenol to avoid inhibition during reverse transcription reaction. Template RNA for RT-PCR has to be free of DNA contamination. It is recommended to use DNase I, RNase-free, to remove trace amounts of DNA from RNA preparations. Always perform a control RT PCR reaction with a RNA template that has not been transcribed with reverse transcriptase. Primers Synthesis of first strand cDNA can be primed with either oligo(dT)18, random primers or gene specific primers. Oligo(dT)18 primers cDNA synthesis from the poly(A) tail present at the 3'-end of eukaryotic mRNA. Random primers, e.g. hexamers, initiate cDNA synthesis from all RNA species (rRNA and mRNA) present in total RNA samples. This results in a greater complexity of the resulting cDNA than using just the oligo(dT)18 primer and may reduce sensitivity and/or specificity of subsequent PCR reaction. However, there are situations where random primers are preferred, such as cDNA synthesis using eukaryotic mRNAs without a poly(A) tail, or cDNA synthesis using a poly(A)-enriched RNA sample as well as RT-PCR of 5' regions of long mRNAs. Gene-specific primers provide the greatest specificity of cDNA synthesis; such primers must be obtained by the user. Enzymes Fermentas offers both wildtype and genetically engineered versions of the Moloney Murine Leukemia Virus (M-MuLV) reverse transcriptase and a recombinant AMV Reverse Transcriptase. All enzymes are suitable for the synthesis of full-length first strand cDNA, but they differ in reaction temperatures, amounts of RNA transcribed, sensitivity and RNaseH activity. See table below for the reaction conditions recommended for each of the enzyme. Enzyme units and RNA amounts are provided for 20 µl of RT reaction volume:
| Reverse transcriptase |
Reaction tmp. |
Active up to |
Reading length |
RHase H activity |
Inactivation |
Units |
Total RNA |
poly(A) RNA |
| Maxima® RT |
50-55°C |
60°C |
20kb |
+ |
85°C, 5min |
200 |
1pg-5µg |
0.1pg-500ng |
| RevertAid™ Premium RT |
50-55°C |
60°C |
20kb |
– |
85°C, 5min |
200 |
1pg-5µg |
0.1pg-500ng |
| RevertAid™ H Minus RT |
42-45°C |
55°C |
13 kb |
– |
70°C, 10min |
200 |
0.1ng-5µg |
10pg-500ng |
| RevertAid™ RT |
42°C |
50°C |
13kb |
+ |
70°C, 10min |
200 |
0.1ng-5µg |
10pg-500ng |
| M-MuLV RT |
37°C |
37°C |
9kb |
+ |
70°C, 10min |
40 |
100ng-5µg |
10-500ng |
| AMV RT |
45-60°C |
60°C |
13kb |
++ |
85°C, 5min |
10 |
10ng-5µg |
1-100ng |
- Removal of Genomic DNA from RNA Preparations
- Add to an RNase-free tube:
| RNA |
1 µg |
| 10X reaction buffer with MgCl2 |
1 µl | | DNase I, RNase-free | 1 µl (1 u) |
| DEPC-treated Water | to 10 µl |
| Total volume |
10 µl |
- Incubate 30 min at 37°C.
- Add 1 µl of 50 mM EDTA and incubate 10 min at 65°C. RNA hydrolyzes if heated in the absence of a chelating agent (1).
- Use the prepared RNA as a template for reverse transcriptase.
Note
- Do not use more than 1 u of DNase I, RNase-free per µg of RNA.
- Reaction mixture can be scaled up for larger amounts of RNA. The recommended final concentration of RNA is 0.1-0.2 µg/µl.
- RiboLock™ RNase Inhibitor (#EO0381), typically at 1 u/µl, can also be included in the reaction mixture to inactivate type A RNases potentially present in the initial RNA solution
Reference
- Wiame, I., et al., Irreversible heat inactivation of DNase I without RNA degradation, BioTechniques, 29, 252-256, 2000.
- First Strand cDNA Synthesis, an example (reaction set up)
- This protocol is provided for first strand cDNA synthesis using RevertAid™ H Minus Reverse Transcriptase. The table below indicates reaction conditions recommended for each RT. Enzyme units and RNA amounts are provided for 20 µl of RT reaction volume:
| Reverse transcriptase | Reaction tmp. | Active up to | Reading length | RHase H activity | Inactivation | Units | Total RNA | poly(A) RNA |
| Maxima® RT | 50-55°C | 60°C | 20kb | + | 85°C, 5min | 200 | 1pg-5µg | 0.1pg-500ng |
| RevertAid™ Premium RT | 50-55°C | 60°C | 20kb | – | 85°C, 5min | 200 | 1pg-5µg | 0.1pg-500ng |
| RevertAid™ H Minus RT | 42-45°C | 55°C | 13 kb | – | 70°C, 10min | 200 | 0.1ng-5µg | 10pg-500ng |
| RevertAid™ RT | 42°C | 50°C | 13kb | + | 70°C, 10min | 200 | 0.1ng-5µg | 10pg-500ng |
| M-MuLV RT | 37°C | 37°C | 9kb | + | 70°C, 10min | 40 | 100ng-5µg | 10-500ng |
| AMV RT | 45-60°C | 60°C | 13kb | ++ | 85°C, 5min | 10 | 10ng-5µg | 1-100ng |
Master Mix. To prepare several parallel reactions and to minimize the possibility of pipetting errors and contamination, prepare a RT master mix by adding all reaction components except RNA into one vial. Prepare enough master mix for the number of reactions and add one extra to compensate for pipetting errors. Sample template RNA into individual tubes and keep on ice. Aliquote the prepared master mix into tubes with RNA. Mix and briefly centrifuge all components after thawing, keep on ice.
- Add into sterile, nuclease-free tube on ice in the indicated order:
| Template RNA | total RNA or poly(A) RNA or specific RNA | 10 ng – 5 µg 1-500 ng 0.01 pg – 0.5 µg | | Primer | Oligo(dT)18 or Random hexamer or Gene-specific | 0.5 µg (100 pmol) 0.2 µg (100 pmol) 15-20 pmol | | DEPC-treated Water | | to 12.5 µl | | Total volume | | 12.5 µl |
|---|
- Optional: If RNA template is GC rich or is known to contain secondary structures, mix gently, centrifuge briefly and incubate at 65°C for 5 min, chill on ice, briefly centrifuge and place on ice.
- Add the following components in the indicated order:
| 5X reaction buffer |
4 µl
|
| RiboLock™ RNase Inhibitor |
0.5 µl (20 u) |
| dNTP Mix, 10 mM each |
2 µl (1 mM final concentration) |
| RevertAid™ H Minus Reverse Transcriptase |
1 µl (200 u) |
| Total volume |
20 µl |
- Mix gently and centrifuge briefly.
- If oligo(dT)18 primer or gene-specific primer is used, incubate 60 min at 42°C. If random hexamer primers are used, incubate 10 min at 25°C followed by 60 min at 42°C. For transcription of GC rich RNA reaction temperature can be increased to 45°C.
- Terminate the reaction by heating at 70°C for 10 min.
Note
- The reverse transcription reaction product can be directly used in PCR or stored at -20°C.
- Use 2 µl of the reaction mix to perform PCR in 50 µl of reaction volume.
Ligation
- DNA Insert Ligation (sticky-end and blunt-end) into Vector DNA
- Sticky-end ligation
- Prepare the following reaction mixture:
| Linear vector DNA |
20-100 ng |
| Insert DNA |
1:1 to 5:1 molar ratio over vector |
| 10X T4 DNA Ligase buffer |
2 µl |
| T4 DNA Ligase |
1 u |
| Water, nuclease-free |
to 20 µl |
| Total volume |
20 µl |
- Incubate 10 min at 22°C.
- Use up to 5 µl of the mixture for transformation of 50 µl of chemically competent cells or use 1-2 µl per 50 µl electrocompetent cells.
Note
- The electrotransformation efficiency may be improved by:
– heat inactivation of T4 DNA Ligase at 65°C for 10 min or at 70°C for 5 min,
– purification of DNA, using GeneJET™ PCR Purification Kit (#K0701), or by chloroform extraction.
- The overall number of transformants may be increased by extending the reaction time to 1 hour.
- If more than 2 u of T4 DNA Ligase is used in 20 µl reaction mixture, it is necessary to purify DNA (by spin column or chloroform extraction) before electrotransformation.
Blunt-end ligation
- Prepare the following reaction mixture:
| Linear vector DNA |
20-100 ng |
| Insert DNA |
1:1 to 5:1 molar ratio over vector |
| 10X T4 DNA Ligase buffer |
2 µl |
| 50% PEG 4000 solution |
2 µl |
| T4 DNA Ligase |
5 u |
| Water, nuclease-free |
to 20 µl |
| Total volume |
20 µl |
- Incubate 1 hour at 22°C.
- Use up to 5 µl of the mixture for transformation of 50 µl of chemically competent cells. Purify DNA for electrotransformation, using the GeneJET™ PCR Purification Kit (#K0701), o by chloroform extraction. Use 1-2 µl of DNA solution per 50 µl of electrocompetent cells.
- Self-circularization of Linear DNA
- Prepare the following reaction mixture:
| Linear DNA |
10-50 ng |
| 10X T4 DNA Ligase buffer |
5 µl |
| T4 DNA Ligase |
5 u |
| Water, nuclease-free |
to 50 µl |
| Total volume |
50 µl |
- Mix thoroughly, spin briefly and incubate:
– sticky-ends for 10 min at 20°C,
– blunt-ends for 1 hour at 22°C.
- Use up to 5 µl of the mixture for transformation of 50 µl chemically competent cells and 1-2 µl per 50 µl of electrocompetent cells.
Note
- The electrotransformation efficiency may be improved by:
– heat inactivation of T4 DNA Ligase at 65°C for 10 min or at 70°C for 5 min,
– purification of DNA, using GeneJET™ PCR Purification Kit (#K0701), or by chloroform extraction.
- The overall number of transformants may be increased by extending the reaction time to 1 hour.
IMPORTANT NOTES
- Polyethylene glycol (PEG) greatly increases the ligation efficiency of blunt-end DNA ligation. The recommended concentration of PEG 4000 in the ligation reaction mixture is 5% (w/v).
- Do not exceed the recommended amount of T4 DNA Ligase in the rection mixture.
- Binding of T4 DNA Ligase to DNA may result in a band shift in agarose gels. To avoid this, incubate samples with 6X Loading Dye & SDS Solution (#R1151) at 70°C for 5 min and chill on ice prior to loading.
- For efficient transformation, the volume of the ligation reaction mixture should not exceed 10% of the competent cell volume.
- Linker Ligation
- Double stranded oligonucleotide linkers are often used to generate compatible overhangs not found in the insert. Linkers normally contain restriction enzyme recognition sequences and are digested after ligation to generate overhangs compatible with cloning vectors. Alternatively, linkers may have overhangs which are ready for ligation with a cloning vector and do not require further manipulation following ligation.
- Prepare the following reaction mixture:
| Linear DNA |
100-500 ng |
| Phosphorylated linkers |
1-2 µg |
| 10X T4 DNA Ligase buffer |
2 µl |
| 50% PEG 4000 solution |
2 µl |
| T4 DNA Ligase |
2 u |
| Water, nuclease-free |
to 20 µl |
| Total volume |
to 20 µl |
- Mix thoroughly, spin briefly and incubate for 1 hour at 22°C.
- Heat inactivate at 65°C for 10 min or at 70°C for 5 min.
NoteT4 DNA Ligase is active in PCR and restriction digestion buffers (see table below). Therefore, linker ligation reactions can be performed in the restriction enzyme buffer optimal for the subsequent digestion. In this case, the ligation reaction should be supplemented with ATP to a final concentration of 0.5 mM. After inactivation of the T4 DNA Ligase, add the restriction enzyme directly to the reaction mixture and incubate according to the digestion protocol.
| Activity in PCR and restriction digestion buffers |
| Buffers |
Activity*, % |
| PCR and RT buffers |
75 |
| Restriction buffers for restriction enzymes |
FastDigest®, 1X / 2X Tango™, B, G, O, R, KpnI, BamHI, EcoRI |
75-100 |
| Ecl136II, SacI |
50 |
* activity of T4 DNA Ligase in variuos buffers supplemented with 0.5 mM ATP.
- Analysis of Ligation Products by Agarose Gel Electrophoresis
- Ligation efficiency can be assesed by agarose gel electrophoresis of ligation reaction products. For sample loading, usage of SDS-supplemented loading dye, e.g. 6X DNA Loading Dye & SDS Solution is recommended to eliminate band shift due to T4 DNA ligase binding to DNA (see picture below).
- Prepare the loading mixture:
| Ligation reaction product |
10 µl |
| 6X DNA Loading Dye & SDS Solution |
2 µl |
- Heat the sample for 10 min at 65°C or for 5 min at 70°C and load.
 Figure 1. Analysis of ligation reaction products on an agarose gel. 400 ng vector and insert in total were used. Real ligation experiments normally use less DNA, therefore bands on a gel may appear at lower intensity. M – GeneRuler™ DNA Ladder Mix (#SM0331) 1 – mixture of DNA insert and vector (400 ng DNA in total) in T4 DNA ligase buffer 2 – mixture of DNA insert and vector (400 ng DNA in total) after the ligation Sample loaded with 6X DNA Loading Dye (#R0611) 3 – mixture of DNA insert and vector (400 ng DNA in total) after the ligation Sample loaded with 6X DNA Loading Dye & SDS Solution (#R1141) Interpretation of results
- Appearance of higher molecular weight bands and decreased intensity of the vector and insert bands indicate successful ligation.
- Unchanged band pattern after ligation indicates unsuccessful ligation.
- Control Reaction for T4 DNA Ligase Activity
- Unsuccessful ligation may be a result of inactivated ligase or inhibition of ligation reaction by impurities in sample DNA. To assess the activity of T4 DNA ligase we recommend to perform ligation reaction with control DNA, e.g. Lambda DNA/HindIII DNA Marker.
- Prepare the control ligation mixture:
| Lambda DNA/HindIII DNA Marker (#SM0101) |
1 µl (0.5 µg) |
| 10X T4 DNA Ligase Buffer |
2 µl |
| T4 DNA Ligase |
1 u |
| Water, nuclease-free |
to 20 µl |
| Total volume |
to 20 µl |
- Mix thoroughly, spin briefly to collect all drops and incubate at 22°C for 10 min.
- Prepare the loading mixture:
| Ligation reaction product | 10 µl |
| 6X DNA Loading Dye & SDS Solution | 2 µl |
 Figure 1.Evaluation of T4 DNA Ligase activity in control experiment. 1 – Lambda DNA/HindIII fragments, unligated 2 – Lambda DNA/HindIII after ligation reaction Interpretation of results
- Appearance of higher molecular weight bands and decreased intensity of the lower molecular weight bands indicates the active ligase.
- Unchanged band pattern after ligation indicates inactivated ligase.
- Fast Sticky-end or Blunt-end DNA Ligation using the Rapid DNA Ligation Kit
- Protocol for fast sticky-end or blunt-end DNA ligation in only 5 min at room temperature using the Rapid DNA Ligation Kit, in pdf (120 KB).
DNA Blunting
- Blunting of 5'- or 3'-overhangs with T4 DNA Polymerase
- T4 DNA Polymerase fills-in 5'-overhangs and removes 3'-overhangs.
- Prepare the following reaction mixture:
| 5X reaction buffer for T4 DNA Polymerase |
4 µl |
| Linear DNA or PCR product |
1 µl |
| dNTP Mix, 2 mM each |
1 µl (0.1 mM final concentration) |
| T4 DNA Polymerase |
0.2 µl (1 u) |
| Water, nuclease-free |
to 20 µl |
| Total volume |
to 20 µl |
- Mix thoroughly, spin briefly and incubate at 11°C for 20 min or at room temperature for 5 min.
- Stop the reaction by heating at 75°C for 10 min.
- Fill-in of 5'-overhangs with Klenow Fragment
- Prepare the following reaction mixture:
| Linear DNA |
10-15 µl (0.1-4 µg)
|
| 10X reaction buffer for Klenow Fragment |
2 µl |
| dNTP Mix, 2 mM each |
0.5 µl (0.05 mM final concentration) |
| Klenow Fragment |
0.1-0.2 µl (1-5 u) |
| Water, nuclease-free |
to 20 µl |
| Total volume |
20 µl |
- Mix thoroughly, spin briefly and incubate at 37°C for 10 min.
- Stop the reaction by heating at 75°C for 10 min.
- Removal of 3'-, 5'-overhangs with S1 Nuclease
- S1 Nuclease removes 3' and 5' single stranded DNA overhangs and hairpin loops. The activity of S1 Nuclease is substrate-dependent and the optimal enzyme and DNA amounts for successful blunting should be determined experimentally.
- Prepare the following reaction mixture:
| DNA |
~1 µg |
| 5X reaction buffer for S1 Nuclease |
6 µl |
| S1 Nuclease |
0.1 µl (10 u) |
| Water, nuclease-free |
to 30 µl |
| Total volume |
30 µl |
- Incubate the mixture at room temperature for 30 min.
- Stop the reaction by adding 2 µl of 0.5 M EDTA and heating at 70°C for 10 min.
NoteThe S1 Nuclease can be diluted with 1X reaction buffer immediately prior to use.
Phosphorylation
- Phosphorylation of DNA with T4 Polynucleotide Kinase
- Prepare the following reaction mixture:
Linear ds DNA or Oligonucleotide | 1-20 pmol of 5'-termini or 10-50 pmol | | 10X reaction buffer A for T4 Polynucleotide Kinase | 2 µl | | ATP, 10 mM* | 2 µl | | T4 Polynucleotide Kinase | 1 µl (10 u) | | Water, nuclease-free | to 20 µl | | Total volume | 20 µl | * Prepare 10 mM ATP solution by combining 10 µl of 100 mM ATP solution and 90 µl of Water, nuclease-free. - Mix thoroughly, spin briefly and incubate at 37°C for 20 min.
- Heat at 75°C for 10 min.
NoteVisit REviewer™ for molar calculations.
Dephosphorylation
- Dephosphorylation of DNA 5'-termini with FastAP™ Thermosensitive Alkaline Phosphatase
- This protocol is suitable for removal of 3'- and 5'-phosphate groups from DNA and RNA. The protocol below is an example for dephosphorylation of ~3 kb linear vector DNA.
- Prepare the following reaction mixture:
| Linear DNA (~3 kb plasmid) | 1 µg (~1 pmol termini) | | 10X FastAP™ reaction buffer | 2 µl | | FastAP™ Thermosensitive Alkaline Phosphatase | 1 µl (1 u) | | Water, nuclease-free | to 20 µl | | Total volume | 20 µl | - Mix thoroughly, spin briefly and incubate at 37°C for 10 min.
- Stop reaction by heating at 75°C for 5 min.
NoteFor efficient dephosphorylation plasmid DNA should be free of RNA and genomic DNA.
- Dephosphorylation of DNA 5'-termini with Shrimp Alkaline Phosphatase
- This protocol is suitable for removal of 3'- and 5'-phosphate groups from DNA and RNA. The protocol below is an example for dephosphorylation of ~3 kb linear vector DNA.
- Prepare the following reaction mixture:
| Linear DNA (~3 kb plasmid) | 1 µg (~1 pmol termini) | | 10X SAP reaction buffer | 2 µl | | Shrimp Alkaline Phosphatase (SAP) | 1 µl (1 u) | Water, nuclease-free | to 20 µl | | Total volume | 20 µl | | - Mix thoroughly, spin briefly and incubate at 37°C for 30 min (5'-overhangs or blunt ends) or 60 min (3'-overhangs).
- Stop reaction by heating at 65°C for 15 min.
NoteFor efficient dephosphorylation plasmid DNA should be free of RNA and genomic DNA.
- Fast Simultaneous Plasmid Vector Linearization and Dephosphorylation
- Prepare the following reaction mixture containing:
| Plasmid DNA |
1 µg |
| 10X FastDigest® buffer |
2 µl |
| FastDigest® Restriction Enzyme |
1 µl |
| FastAP™ Thermosensitive Alkaline Phosphatase |
1 µl |
| Water, nuclease-free |
to 20 µl |
| Total volume |
20 µl |
- Mix thoroughly, spin briefly and incubate at 37°C for 10 min.
- Stop reactions by heating at 65°C for 15 min or at 80°C for 20 min (if restriction enzyme is not inactivated at 65°C).
NoteFor FastDigest® SphI (PaeI), simultaneous digestion and dephosphorylation is not recommended. Perform digestion, phenol/chloroform extract and ethanol precipitate digested DNA, dissolve DNA in 1X FastDigest® buffer and dephosphorylate.
- Dephosphorylation of Proteins
- Reaction Mixture:
1X FastAP™ reaction buffer, 0.1-0.2 mg/ml of phosphoprotein, 10 u of FastAP™ Thermosensitive Alkaline Phosphatase. Incubate at 37°C for 1 hour. Note- The reaction can be stopped by addition of a final concentration of 50 mM EDTA (#R1021) or by addition of a final concentration of 10 mM sodium orthovanadate (Na3VO4).
- The optimal incubation time and the enzyme concentration must be determined experimentally for each substrate.
cDNA Synthesis for Cloning
- I. First Strand cDNA Synthesis
- The following protocol is provided for first strand cDNA synthesis using RevertAid™ H Minus Reverse Transcriptase.
All Fermentas reverse transcriptases (RT) are suitable for the synthesis of full-length first strand cDNA, but they differ in reaction temperatures, amounts of RNA transcribed, sensitivity and RNase H activity. The table below indicates reaction conditions recommended for each RT. Enzyme units and RNA amounts are provided for 20 µl of RT reaction volume:
| Reverse transcriptase | Reaction temp. | Active up to | Reading length | RHase H activity | Inactivation | Units | Total RNA | poly(A) RNA |
| Maxima® RT | 50-55°C | 60°C | 20kb | + | 85°C, 5min | 200 | 10pg-5µg | 0.1pg-500ng | | RevertAid™ Premium RT | 50-55°C | 60°C | 20kb | – | 85°C, 5min | 200 | 10pg-5µg | 1pg-500ng |
| RevertAid™ H Minus RT | 42-45°C | 55°C | 13 kb | – | 70°C, 10min | 200 | 0.1ng-5µg | 10pg-500ng |
| RevertAid™ RT | 42°C | 50°C | 13kb | + | 70°C, 10min | 200 | 0.1ng-5µg | 10pg-500ng |
| M-MuLV RT | 37°C | 37°C | 9kb | + | 70°C, 10min | 40 | 100ng-5µg | 10-500ng | | AMV RT | 45-60°C | 60°C | 13kb | ++ | 85°C, 5min | 10 | 10ng-5µg | 1-100ng | Master Mix. To prepare several parallel reactions and to minimize the possibility of pipetting errors and contamination, prepare a RT master mix by adding all reaction components except RNA into one vial. Prepare enough master mix for the number of reactions and add one extra to compensate for pipetting errors. Sample template RNA into individual tubes and keep on ice. Aliquote the prepared master mix into tubes with RNA. Mix and briefly centrifuge all components after thawing, keep on ice.
- Add into sterile, nuclease-free tube on ice in the order given:
| poly(A)+ mRNA or | 1 µg |
| Total RNA or | 5 µg |
| Specific RNA transcript | 0.5-1 µg |
| Oligo(dT)18 primer (0.5 µg/µl) or | 0.5 µg |
| Random hexamer primer (0.2 µg/µl) or | 0.2 µg |
| Gene-specific primer | 100 pmol |
| DEPC-treated Water | to 11.5 µl |
| Total volume | 11.5 µl |
- Optional (if RNA template is GC-rich or is known to contain secondary structures). Mix gently and briefly centrifuge, incubate at 65°C for 5 min, chill on ice and briefly centrifuge, then place the tube on ice.
- Add in the order given:
| 5X reaction buffer for reverse transcriptase | 4 µl | | RiboLock™ RNase Inhibitor | 0.5 µl (20 u) | | dNTP Mix, 10 mM each | 2 µl (1 mM final concentration) | | RevertAid™ H Minus Reverse Transcriptase | 1 µl (200 u) | | Total volume | 20 µl |
|---|
- Mix gently and briefly centrifuge.
- If oligo(dT)18 primer or gene-specific primer is used, incubate 60 min at 42°C.
If random hexamer primer is used, incubate 10 min at 25°C followed by 60 min at 42°C. For reverse transcription of GC-rich RNA reaction temperature can be increased up to 45°C. - Terminate the reaction by heating at 70°C for 10 min.
The reverse transcription reaction product can be directly used in second strand cDNA synthesis or stored at -20°C.
- II. Second Strand cDNA synthesis
- Perform first strand cDNA synthesis reaction according to recommendations provided for a specific reverse transcriptase.
- Add the following (on ice) to 20 µl of first strand cDNA synthesis reaction mixture:
| 10X reaction buffer for DNA Polymerase I |
8 µl |
| RNase H |
0.2 µl (1 u) |
| DNA Polymerase I |
3 µl (30 u) |
| Water, nuclease-free |
88.8 µl |
| Total volume |
100 µl |
- Gently vortex and briefly centrifuge.
- Incubate at 15°C for 2 hours. Do not let the temperature rise above 15°C.
- Add 2.5 µl (12.5 u) of T4 DNA Polymerase and incubate at 15°C for 5 min.
- Terminate the reaction by adding 5 µl of 0.5 M EDTA, pH 8.0.
Phenol/chloroform purified blunt-end cDNA can be used for further cloning related procedures e.g. adapter ligation, phosphorylation, size fractionation, ligation and transformation.
Transformation
- General Recommendations for Transformation
- The number of transformants on the plates directly depends on the transformation efficiency of the competent cells. For successful cloning competent E.coli cells should have an efficiency of at least 1x106 transformants per µg supercoiled plasmid DNA. To check the efficiency, prepare a control transformation with 0.1 ng of a supercoiled vector DNA (e.g. pUC19 DNA (#SD0061)).
Sample calculation of transformation efficiency
For 500 colonies (cfu) on a control plate, the transformation efficiency is calculated as follows:
500 cfu / 0.1 ng of control DNA plated X 1000 ng/µg = 5 X 106 cfu/µg DNA.
Transformation tips
- When using commercial competent cells, follow the recommendations from the supplier.
- Use up to 5 µl of the ligation mixture per 50 µl of chemically competent cells including competent cells produced with TransformAid™ Bacterial Transformation Kit.
- For transformation by electroporation, extract the ligation reaction mixture with chloroform or a commercial spin column. Use 1 µl of purified ligation mixture to transform 50 µl of electrocompetent cells.
- Ligation efficiency often decreases as the insert size increases. Therefore, for vector containing large inserts (>3 kb) we recommend transformation by electroporation as it yields the highest transformation efficiencies (109 cfu/µg supercoiled DNA).
- For fast cloning use competent cells prepared with the TransformAid™ Bacterial Transformation Kit. The TransformAid™ Bacterial Transformation Kit constantly yields efficiencies of 107 cfu/µg supercoiled DNA.
- Preparation of E.coli Culture Glycerol Stocks
- Transformation efficiency and subsequent analysis of recombinant plasmids depends on the quality of the E.coli strains used in laboratory. Proper storage is vital to ensure competent cells retain high transformation efficiency. Agar plates are only suitable for short term 4°C storage. A glycerol stock kept at -70°C is the ideal way to store bacterial strains.
- When a lyophilized bacterial strain is purchased, a small portion of the powder is transferred with a sterile pipette tip or inoculating loop to liquid LB medium and incubated for 2-8 hours in a shaker.
- A drop of liquid culture is spread on a selective plate and propagated overnight at 37°C to check for presence of selective markers.
- Select a single colony and grow overnight.
- Add 180 µl of 87% sterile glycerol to a 2 ml screw-cap culture vial.
- Add 820 µl of liquid E.coli culture to vial, mix well, freeze in liquid nitrogen and store at -70°C.
When recovering bacteria from a glycerol stock, it is recommended to check for selective markers by streaking an aliquot on a selective plate.
- Preparation of X-Gal/IPTG LB Agar Plates for Blue/White Colony Screening
- For individual LB (Luria Broth) agar plates:
- Pour sterile warm LB agar (about 25 ml) into a Petri dish.
- Dry opened LB plates at room temperature under UV light for about 30 min.
- Add 40 µl of the X-Gal Solution (20 mg/ml), ready-to-use.
- Add 40 µl of 100 mM IPTG Solution, ready-to-use.
- Spread evenly on the plate with a sterile spatula.
For batch use, add the following directly per 1 ml of the liquid LB agar (kept at about 50°C):
- 1 µl of X-Gal Solution (20 mg/ml), ready-to-use.
- 1 µl of 100 mM IPTG Solution, ready-to-use.
- Mix well.
- Pour 25 ml of prepared LB agar into each Petri dish.
- Dry opened LB plates at room temperature under UV light for about 30 min.
- Analysis of Recombinant Clones
- Analyze 4-6 white colonies for the presence and orientation of the DNA insert using one of the following methods.
Restriction analysis. Isolate plasmid DNA from an overnight bacterial culture using a convenient plasmid miniprep method such as GeneJET™ Plasmid Miniprep Kit. Use FastDigest® restriction enzymes to digest DNA from recombinant clones in just 5 min.
Sequencing. Isolate plasmid DNA from an overnight bacterial culture using a reliable plasmid miniprep method such as GeneJET™ Plasmid Miniprep Kit. Sequence the insert using appropriate sequencing primers.
Colony PCR. Use the following protocol for colony screening by PCR.
- Prepare enough PCR master mix for the number of colonies analyzed plus one extra. For each 20 µl of reaction, mix the following reagents:
| Component |
Taq DNA Polymerase or DreamTaq™ DNA Polymerase |
PCR Master Mix (2X) |
| 10X Taq buffer |
2 µl |
- |
| dNTP Mix, 2mM each |
2 µl |
- |
| 25 mM MgCl2 |
1.2 µl |
- |
| M13/pUC Reverse Sequencing primer (#SO101) |
0.6 µl (10 µM) |
0.6 µl (10 µM) |
| M13/pUC Forward Sequencing primer (#SO100) |
0.6 µl (10 µM) |
0.6 µl (10 µM) |
| Taq DNA polymerase |
0.1 µl (0.5 u) |
- |
| PCR Master Mix (2X) |
- |
10 µl |
| Water, nuclease-free |
to 20 µl |
to 20 µl |
| Total volume |
20 µl |
20 µl |
- Mix thoroughly, spin briefly and aliquot 20 µl of the mix into the PCR tubes on ice.
- Pick up an individual colony with a sterile pipette tip and resuspend it in 20 µl of the PCR master mix. Make a short strike with the same tip over culture plate to save the clone for repropagation.
- Perform PCR: 95°C, 3 min; 94°C, 30 s, 45°C*, 30 s, 72°C 1 min/kb; 30 cycles.
- Analyze on a gel for the presence of the PCR product of the expected length.
* Depends on primer pair used (Tm-5).
- Transformation from Overnight E.coli Culture (for 2 transformations)
- Add 150 µl of the overnight culture to 1.5 ml of pre-warmed C-Medium. Incubate for 20 min in a 37°C shaker.
- Prepare T-Solution – mix 250 µl of T-Solution (A) and 250 µl of T-Solution (B). Keep on ice.
- Centrifuge refreshed bacterial cells for 1 min in a microcentrifuge to pellet the cells.
- Resuspend cells in 300 µl of T-Solution. Incubate 5 min on ice.
- Centrifuge for 1 min in a microcentrifuge and resuspend cells in 120 µl of T-Solution. Incubate 5 min on ice.
- Add 1 µl of supercoiled DNA (10-100 pg) or up to 5 µl of ligation mixture (10-100 ng vector DNA) into new microcentrifuge tubes. Chill 2 min on ice.
- Add 50 µl of the prepared cells to each tube containing DNA. Incubate 5 min on ice.
- Plate immediately on pre-warmed LB-Ampicillin agar plates. Incubate overnight at 37°C.
- Rapid Preparation of Competent E.coli Cells with the TransformAid™ Bacterial Transformation Kit
- A novel method for rapid preparation of chemically competent E.coli cells from overnight bacterial cultures or bacterial colonies using the TransformAid™ Bacterial Transformation Kit, in pdf (136 KB).
Purification of DNA from Cultured Eukaryotic Cells with Proteinase K
- Purification of Genomic DNA from Mouse Tail with Proteinase K
- Place a 0.5-1 cm sample of mouse tail into a 1.5 ml microcentrifuge tube.
- Add 500 µl of lysis buffer (50 mM KCl, 50 mM Tris-HCl (pH 8.0), 2.5 mM EDTA, 0.45% NP-40, 0.45% Tween-20).
- Add 2.5 µl of Proteinase K, 20 mg/ml and mix briefly.
- Incubate overnight at 55°C.
Optional. Incubate for an additional 1 hour at 65°C.
- Vortex and spin 10 seconds at 13,000 rpm to collect cell debris.
- Use 1 µl from the top part of the supernatant per 50 µl of PCR mix.
- Purification of DNA from Cultured Eukaryotic Cells with Proteinase K
- Determine the number of cells. The following protocol is used for for 1-2x106 cells.
- Centrifuge for 5 min at 3000 rpm in a microcentrifuge to collect the cells.
- Wash the pellet twice with PBS (137 mM NaCl, 27 mM KCl, 100 mM Na2HPO4, 2 mM K2HPO4, pH 7.4).
- Resuspend the pellet in 0.5 ml of lysis buffer (10 mM Tris-HCl, pH 8.5, 5 mM EDTA, 200 mM NaCl, 0.2% SDS). Incubate at 60°C for 5 min.
- Add 2.5 µl of Proteinase K and 5 µl of RNase A/T1 Mix, mix. Incubate at 60°C for 1 h.
- Add 250 µl of 5 M NaCl, mix and incubate on ice for 5 min to precipitate protein.
- Centrifuge for 15 min at 10,000 rpm in a microcentrifuge.
- Transfer supernatant to a fresh tube. Add an equal volume of isopropanol and mix to precipitate the DNA.
Optional. Incubate at -20°C for up to 60 min to increase the yield of DNA.
- Centrifuge for 10 min at 10,000 rpm in a microcentrifuge.
- Discard the supernatant and wash the pellet with 1.2 ml 70% cold ethanol.
- Air-dry the pellet (do not use a vacuum dryer or let the pellet dry completely. Dried genomic DNA has low solubility). Dissolve the pellet in Water, nuclease-free or TE buffer.
Note
- The typical yield of DNA from 106 cells is 7-15 µg.
- Purification of Plasmid DNA using the GeneJET™ Plasmid Miniprep Kit
- Protocol for simple, rapid and cost-effective isolation of high quality plasmid DNA from recombinant E.coli cultures using the GeneJET™ Plasmid Miniprep Kit, in pdf (55 KB).
- Purification of DNA from PCR and other Reaction Mixtures using the GeneJET™ PCR Purification Kit
- Protocol for rapid and efficient purification of DNA from PCR and other enzymatic reaction mixtures using the GeneJET™ PCR Purification Kit, in pdf (60 KB).
- Purification of genomic DNA from variuos sources using the GeneJET™ Genomic DNA Purification Kit
- Protocol for fast and efficient purification of high quality genomic DNA from whole blood, mammalian cell cultures, mammalian tissues and bacteria using the GeneJET™ Genomic DNA Purification Kit, in pdf (153 KB).
- Purification of genomic DNA from variuos sources using the Genomic DNA Purification Kit
- Protocol for simple and rapid purification of high quality genomic DNA from whole blood or serum, cell cultures, plant tissues, mammalian tissues, epithelium samples and bacteria using the Genomic DNA Purification Kit, in pdf (41 KB).
Extraction of DNA from Agarose Gel
- Casting High Quality Agarose Gels
- Use the same 1X electrophoresis buffer to prepare the gel and to run electrophoresis.
- For analysis of linear DNA fragments add ethidium bromide to the electrophoresis buffer and gel at 0.5 µg/ml concentration. Wear gloves when handling ethidium bromide.
- For reliable in-gel analysis of circular supercoiled or relaxed plasmid DNA, do not include ethidium bromide in the electrophoresis buffer or gel. The gel should be stained only after electrophoresis.
- Ethidium bromide and exposure to UV light cause DNA alterations. Therefore, avoid UV exposure and ethidium bromide if DNA is to be purified from the gel for cloning experiments.
- For preparation of the agarose gel use a flask of at least three times larger volume than that of the solution to avoid solution loss due to boiling.
Procedure:
- Weigh out the required amount (depending on the gel percentage) of agarose into an Erlenmeyer flask and add the appropriate volume of either 1X TBE or 1X TAE buffer, swirl to mix.
- Weigh the flask with the solution.
- For high percentage (3-5%) agarose gels: add a 10-20% excess amount of distilled water.
- Boil the mixture in a microwave oven at medium power until the agarose is completely molten, swirl several times while boiling.
To prepare the highest quality agarose gels of any percentage, an additional 3-5 min boiling after complete melting of the agarose is recommended.
- Weigh the flask again and, if necessary, add hot distilled water to restore the evaporated water (or continue boiling) to obtain the correct percentage agarose gel.
Optional. Add ethidium bromide to a final concentration of 0.5 µg/ml, mix well and heat the mixture for an additional minute without boiling.
- Cool the solution to 65-70°C. Pour carefully on a clean casting plate with an appropriate comb. If bubbles appear, push them carefully away to the sides with a tip.
- Allow the gel to solidify for about 30 min before using. Low percentage LM agarose gels can only be solidified at 4°C.
- Immerse the gel into the desired electrophoresis buffer and load samples.
- After electrophoresis the gel can be stained with ethidium bromide, SYBR® Green I or by any other staining technique.
Warning: hot agarose solution should be handled very carefully.
- Recovery of DNA from LM Agarose Gels with Agarase
- Perform electrophoresis of DNA in low melting point (LM) agarose (#R0801) gel prepared in TAE (#B49), 0.5X TBE, TBE (#B52) or TPE buffer. Stain the gel with ethidium bromide.
- Cut out the desired DNA band from the agarose gel with a clean scalpel under UV light*. Cut out only as much agarose as it is necessary. (The bottom of the excised agarose is free of DNA and should be removed.)
- Determine the weight of the slice. To facilitate melting, cut gel slices larger than 200 mg into smaller pieces.
- Incubate the tube at 70°C for approx. 10 min. Ensure that the agarose is completely melted.
- Transfer the tube to a 42°C water bath and equilibrate for 5 min.
- Add 1 u of Agarase (#EO0461) per 100 mg (approx. 100 µl) of molten 1% low melting agarose. Increase the amount of enzyme proportionally for higher percentage agarose, gently mix and incubate at 42°C for 30 min.
- Add ammonium acetate** to a 2.5 M final concentration, chill on ice for 5 min.
- Centrifuge at 10,000 rpm for 10 min to pellet undigested carbohydrates. Transfer the supernatant to a clean tube.
- Add 2.5 volumes of ethanol or 0.8 volume of isopropanol, mix gently and incubate at room temperature for 1 h. If DNA fragments are smaller than 500 bp or if the DNA concentration is lower than 0.05 µg/ml, incubate at room temperature for 2 h.
- Centrifuge at 10,000 rpm for 15 min, remove supernatant and dry the pellet. Resuspend the pellet in TE or another appropriate buffer for subsequent manipulation.
Note * For subcloning of gel-purified DNA fragments, care should be taken to avoid DNA damage with UV light. Minimize the UV exposure to a few seconds or keep the gel on glass or plastic plate during UV illumination. Alternatively, visible dyes can be included in standard agarose gels to visualize DNA bands in ambient light (1, 2). ** Ammonium acetate, is recommended rather than other salts to avoid co-precipitation of oligosaccharides with DNA. - The procedure typically recovers 90% of DNA from the gel.
- For evaluation of DNA yield use Fermentas DNA ladders/markers, which are ideal for in-gel DNA quantification.
- T4 polynucleotide kinase is inhibited by ammonium ions, therefore use 1 M Sodium Acetate, (0.3 M final concentration) if T4 polynucleotide kinase will be used in downstream applications.
- Large DNA fragments (>30 kb) require delicate handling to avoid mechanical shearing. After digestion with agarase (step 6), centrifuge at maximum speed for 10 min to pellet undigested carbohydrates. Remove oligosaccharides and agarase by dialysis or carry out subsequent manipulations with DNA in the digested agarose solution.
References - Rand, K.N., Crystal Violet can be used to Visualize DNA Bands during Gel Electrophoresis and to Improve Cloning Efficiency, Elsevier Trends Journals Technical Tips Online, T40022, 1996.
2. Adkins, S., Burmeister, M., Visualization of DNA in agarose gels and educational demonstrations, Anal. Biochem., 240 (1), 17-23, 1996.
- Extraction of DNA from Agarose Gels using the GeneJET™ Gel Extraction Kit
- Protocol for rapid and efficient purification of DNA fragments from standard or low-melting point agarose gels using the GeneJET™ Gel Extraction Kit, in pdf (72 KB).
- Extraction of DNA from Agarose Gels and Reaction Mixtures using the Silica Bead DNA Gel Extraction Kit
- Protocol for simple and efficient DNA extraction from agarose gels, prepared with TAE or TBE buffers, and reaction mixtures using the Silica Bead DNA Gel Extraction Kit, in pdf (121 KB).
Precipitation of DNA and RNA
- Nucleic Acid Precipitation from Diluted Solutions with Glycogen
- Add 1/10 volume of 3 M Sodium Acetate (or 2 M sodium chloride, or 5 M ammonium acetate) to DNA solution.
- Add Glycogen (#R0561 for DNA or #R0551 for RNA) to a final concentration of 0.05-1 µg/µl. Use up to 1 µl of Glycogen per 20 µl of solution.
- Add 2.5 volumes of ethanol. Mix gently but thoroughly.
- Incubate for 5 min at room temperature.
- Centrifuge the mixture for 10-15 min at 10,000 rpm. Discard the supernatant.
- Rinse the pellet with cold 70% ethanol. Air-dry the pellet.
- DNA: Dissolve the pellet in Water, nuclease-free or TE buffer.
RNA: Dissolve pellet in DEPC-treated Water.
Removal of DNA from RNA Solutions
- Removal of Template DNA after in vitro Transcription
- Add 2 u of DNase I, RNase-free per 1 µg of template DNA directly to a transcription reaction mixture. In some cases, the amount of enzyme should be determined empirically.
- Incubate at 37°C for 15 minutes.
- Inactivate DNase I by phenol/chloroform extraction.
- Removal of Genomic DNA from RNA Preparations
- Add to an RNase-free tube:
| RNA |
1 µg |
| 10X reaction buffer with MgCl2 |
1 µl | | DNase I, RNase-free | 1 µl (1 u) |
| DEPC-treated Water | to 10 µl |
| Total volume |
10 µl |
- Incubate 30 min at 37°C.
- Add 1 µl of 50 mM EDTA and incubate 10 min at 65°C. RNA hydrolyzes if heated in the absence of a chelating agent (1).
- Use the prepared RNA as a template for reverse transcriptase.
Note
- Do not use more than 1 u of DNase I, RNase-free per µg of RNA.
- Reaction mixture can be scaled up for larger amounts of RNA. The recommended final concentration of RNA is 0.1-0.2 µg/µl.
- RiboLock™ RNase Inhibitor (#EO0381), typically at 1 u/µl, can also be included in the reaction mixture to inactivate type A RNases potentially present in the initial RNA solution
Reference
- Wiame, I., et al., Irreversible heat inactivation of DNase I without RNA degradation, BioTechniques, 29, 252-256, 2000.
Removal of Primers and Nucleotides from PCR Mixtures
- PCR Product Clean-Up Prior to Sequencing
- The clean-up reaction removes unincorporated primers and degrades unincorporated nucleotides. The resulting PCR product is ready to use for sequencing without additional purification, e.g. using column purification kits.
- Prepare the following reaction mixture:
| PCR mixture (directly after completion of PCR) |
5 µl |
| Exonuclease I (Exo I) |
0.5 µl (10 u) |
FastAP™ Thermosensitive Alkaline Phosphatase or Shrimp Alkaline Phosphatase (SAP) |
1 µl (1 u) |
- Mix well and incubate at 37°C for 15 min.
- Stop the reaction by heating the mixture at 85°C for 15 min.
Note
- Up to 5 µl of purified PCR products can be used directly for DNA sequencing without further purification.
- For reliable sequencing results there should not be non-specific PCR products.
- The protocol may be applied for clean-up of PCR products, generated by any thermophilic DNA polymerase or polymerase mix.
- The procedure is not recommended for downstream cloning applications.
Reference
- Werle, E., et al., Convenient single-step, one tube purification of PCR products for direct sequencing, Nucleic Acids Res., 22, 4354-4355, 1994.
Removal of Proteins from Enzymatic Reaction Mixtures
- Phenol/Chloroform Extraction and Ethanol Precipitation
- Mix your sample with 1 volume of Tris-saturated phenol and 1 volume of chloroform. Centrifuge at 10,000 rpm for 5 min at room temperature.
- Transfer the upper aqueous phase to a fresh tube. Add an equal volume of chloroform and mix. Centrifuge at 10,000 rpm for 5 min at room temperature. Repeat.
- Transfer the upper aqueous phase to a fresh tube. Add 1/10 the volume of 3 M Sodium Acetate Solution or 2 M sodium chloride.
- Add 2.5 volumes of ethanol or an equal volume of isopropanol to precipitate DNA.
- Incubate the mixture for 30 min at -20°C.
- Centrifuge for 10 min at 10,000 rpm. Then discard the supernatant and rinse the pellet with 70% cold ethanol.
- Air-dry the pellet. Dissolve in Water, nuclease-free or TE buffer.
Note
Use Glycogen to maximize the yield of DNA during precipitation.
In vitro Transcription
- DNA Template Preparation for in vitro Transcription
- Double stranded linear DNA with blunt or 5'-protruding ends can be used as template for in vitro transcription. Linearized plasmid DNA, PCR products or cDNA can be used as templates for transcription if they contain a double-stranded RNA polymerase promoter region in the correct orientation.
Consensus promoter sequences of different RNA Polymerases: T7 TAATACGACTCACTATAGGG T3 AATTAACCCTCACTAAAGGG SP6 ATTTAGGTGACACTATAGAA G will be the first base (+1) of the RNA transcript The synthesis of sense or antisense RNA transcripts depends on the orientation of the promoter with respect to target sequence. The target sequence must be placed downstream of the promoter for sense RNA and must be inverted for antisense RNA transcription.
Plasmid Templates Quality
Plasmid DNA quality affects transcription yield and the integrity of synthesized RNA. The greatest transcription yields are achieved with the highest purity plasmid templates. Plasmids purified by common laboratory methods can be used if the DNA is free of contaminating RNases, SDS, EDTA, proteins, salts* and RNA. DNA should be have a A260/280 ratio of 1.8-2.0. The GeneJET™ Plasmid Miniprep Kit generates high purity plasmid DNA suitable for transcription.
* T7 and SP6 RNA Polymerases are inhibited by ~50% at NaCl or KCl concentrations above 150 mM and T3 RNA Polymerase – at above 250 mM.
Linearization
To produce RNA transcripts of a defined length, plasmid DNA is linearized by restriction digestion downstream of the insert. Restriction enzymes which generate blunt ends or 5'-overhangs are preferred. 3'-overhangs have been reported to generate spurious transcripts (1) and should therefore be avoided. 3'-overhangs can be blunted by T4 DNA Polymerase prior to transcription.
Due to the high processivity of RNA polymerases, circular plasmid templates generate long heterogeneous RNA transcripts in higher quantities than linear templates. Therefore, it is important to completely linearize plasmid DNA to ensure efficient synthesis of defined length transcripts. If complete digestion is unachievable, gel purify the linearized DNA template band e.g. with a DNA Gel Extraction Kit prior to transcription reactions.
After linearization, it is recommended to purify the DNA template by phenol/chloroform extraction:
- Add 1/10th volume of 3 M Sodium Acetate Solution to the DNA.
- Mix thoroughly.
- Extract with an equal volume of a 1:1 phenol/chloroform mixture, and then twice with an equal volume of chloroform. Collect the aqueous phase and transfer to a new tube.
- Precipitate the DNA by adding 2 volumes of ethanol. Incubate at -20°C for at least 30 min and collect the pellet by centrifugation.
- Remove the supernatant and rinse the pellet with 500 µl of cold 70% ethanol.
- Resuspend the DNA in 20 µl of DEPC-treated water.
PCR Templates PCR products can serve as templates for in vitro transcription. The RNA polymerase promoter must be located upstream of the sequence to be transcribed.
- Avoiding RNase Contamination
- Reagents supplied by Fermentas have been tested to ensure they are endo-, exodeoxyribonuclease, ribonuclease, and phosphatase free. However, an RNase-free working environment and RNase-free solutions are also critical factors for performing successful in vitro transcription.
General recommendations to avoid RNase contamination:
- Maintain a separate area, dedicated pipettors and reagents when working with RNA.
- Wear gloves when handling RNA and reagents to avoid contact with skin, which is a source of RNases. Change gloves frequently.
- Use sterile RNase free plastic tubes.
- Treat water and all solutions used for RNA purification and handling with DEPC. Add DEPC to 0.1% (v/v) final concentration; incubate overnight at room temperature and autoclave.
- High quality reagents must be used for buffer solutions. Buffers containing Tris should be prepared by dissolving Tris base in DEPC-treated water. Solutions containing DTT or nucleotides should be prepared by dissolving in DEPC-treated water and passing the solution through a 0.2 µm filter to sterilize.
- Keep all kit components sealed when not in use and all tubes tightly closed during the transcription reaction.
- Conventional in vitro Transcription
- More than 10 µg of RNA transcript can be generated per 1 µg template DNA using the following protocol. The reaction can be scaled up or down. For high yield transcription, generating up to 200 µg RNA, use TranscriptAid™ T7 High Yield Transcription Kit.
- Thaw frozen reagents, mix and centrifuge briefly.
- Keep enzymes and nucleotides on ice.
- Keep the Reaction Buffer at room temperature.
- Prepare the following reaction mixture at room temperature:
| 5X Transcription buffer |
10 µl |
| ATP/GTP/CTP/UTP Mix, 10 mM each |
10 µl (2 mM final concentration) |
| Linearized template DNA |
1 µg |
| RiboLock™ RNase Inhibitor |
1.25 µl (50 u) |
| T7/T3/SP6 RNA Polymerase |
1.5 µl (30 u) |
| DEPC-treated Water |
to 50 µl |
| Total volume |
50 µl |
- Incubate at 37°C for 2 hours.
- Optional: To remove template DNA add 2 µl (2 u) of DNase I, RNase-free, mix and incubate at 37°C for 15 min.
- Stop the reaction by addition of 2 µl 0.5 M EDTA, pH 8.0 and incubate at 65°C for 10 min.
NoteRNA hydrolyzes if heated in the absence of a chelating agent.
- Synthesis of Radiolabeled RNA Probes of High Specific Activity
- Linearize template DNA with a restriction enzyme. Extract DNA with phenol/chloroform, then with chloroform/isoamyl alcohol, and precipitate with ethanol. Dissolve DNA in DEPC-treated Water.
- Combine the following reaction components at room temperature in the order given:
| 5X Transcription buffer |
4 µl |
| 3 NTP Mix, 10 mM each* (without labeled NTP) |
1 µl (0.5 mM final concentration) |
| 100 µM CTP |
2.4 µl (12 µM final concentration) |
| [alpha-32P]-CTP, ~30 TBq/mmol (800 Ci/mmol) |
1.85 MBq (50 µCi) |
| Linear template DNA |
0.2-1.0 µg |
| RiboLock™ RNase Inhibitor |
0.5 µl (20 u) |
| T7/T3/SP6 RNA Polymerase |
1 µl (20 u) |
| DEPC-treated Water |
to 20 µl |
| Total volume |
20 µl |
- Incubate at 37°C for 2 hours.
- Stop the reaction by cooling at -20°C.
- Determine the percentage of the label incorporated into RNA.
Note
* To prepare a mix of the three non-labeled NTPs 10 mM each, combine 1 µl of all three NTPs, 100 mM, from the set (#R0481) with 7 µl of DEPC-treated Water. Store the mix at -20°C for further use.
- Expect specific radioactivity of 3-5 x108 dpm/µg.
- RNA can be radiolabeled with [32P], [35S] or [3H]-ribonucleotides. Recommended amounts of radiolabeled nucleotides in 20 µl of reaction mixture are as follows: 1.85 MBq (50 µCi) for 5'-[alpha-32P]-CTP, approx. 30 TBq/mmol (800 Ci/mmol); 11.1 MBq (300 µCi) for 5'-[alpha-35S]-UTP, more than 37 TBq/mmol (1000 Ci/mmol); 0.925 MBq (25 µCi) for 5,6-[3H]-UTP, 1.1-2.2 TBq/mmol (30-60 Ci/mmol).
- The yield of the full-length transcripts is reduced when the concentration of labeled NTP is below 12 µM.
- Purification of RNA Transcripts
- Template DNA: may interfere with downstream applications of the RNA transcript. Template DNA should be removed by DNase I digestion directly after the transcription reaction. Add 2 u of DNase I, RNase-free, mix and incubate at 37°C for 15 min, then add 2 µl of 0.5 M EDTA, pH 8.0 and incubate at 65°C for 10 min to stop the reaction.
- Proteins and nucleotides: phenol/chloroform extraction and ethanol precipitation of RNA transcripts is recommended.
- To 50 µl reaction mixture, add 85 µl of DEPC-treated water and 15 µl of 3 M Sodium Acetate. Mix thoroughly.
- Extract with an equal volume of 1:1 phenol/chloroform mixture, and then twice with an equal volume of chloroform. Collect the aqueous phase and transfer to a new tube.
- Precipitate the RNA by adding 2 volumes of ethanol. Incubate at -20°C for at least 30 min and collect the pellet by centrifugation.
- Remove the supernatant and rinse the pellet with 500 µl of cold 70% ethanol.
- Resuspend the RNA in 20 µl of DEPC-treated water.
- Store the RNA at -20°C or -70°C.
- Evaluation of Transcription Products: Quantification by UV Light Absorbance
- The easiest way to determine RNA concentration is to measure the ultraviolet light absorbance at a wavelength of 260 nm. Dilute an aliquot of the conventional transcription reaction 1:20 (1:300 for high yield transcription) to obtain an absorbance reading in the linear range of a spectrophotometer. For single-stranded RNA, when A260 = 1, RNA concentration is 40 µg/ml. The RNA yield can be calculated as follows:
A260 x (dilution factor) x 40 = µg/ml RNA.
NoteUnincorporated nucleotides and template DNA in the mixture will interfere with quantification. Therefore, it is advisable to remove template and nucleotides from transcription mixture.
- Evaluation of Transcription Products: Sizing and Quantification by Gel Electrophoresis
- To evaluate transcript length, integrity and quantity, an aliquot of the transcription reaction should be run on a native or denaturing agarose gel or polyacrylamide gel along with the appropriate RNA ladder, e.g. RiboRuler™ High Range or RiboRuler™ Low Range RNA Ladder.
| Transcript length |
Recommended gel |
| >500 bases |
1% agarose gel |
| 100-500 bases |
2% agarose or 4-5% denaturing polyacrylamide gel |
| 50-100 bases |
10% denaturing polyacrylamide gel or 2-3% agarose gel |
| <50 bases |
20% denaturing polyacrylamide gel or 3-4% agarose gel |
- Recommendations for RNA Sample Loading
- Use only fresh electrophoresis buffers and freshly poured gels.
- Use clean electrophoresis chambers. For RNA gel analysis, avoid electrophoresis tanks used for DNA miniprep analysis since DNA minipreps often contain RNase A or T1.
- Use the RiboRuler™ High Range or RiboRuler™ Low Range RNA Ladder for sizing and approximate quantification of the transcript.
- Use the same loading dye for samples and RNA ladders. 2X RNA Loading Dye is available separately and is provided with all Fermentas RiboRuler™ RNA Ladders. The loading dye contains ethidium bromide for RNA visualization on denaturing formaldehyde gels.
- For native gels, add 0.5 µg/ml of ethidium bromide to the agarose gel and to the running buffer.
- Dilute the RNA transcript with DEPC-treated water to a final concentration of 0.1-0.5 µg/µl.
- Mix 2-4 µl (0.5-1 µg RNA) of diluted sample with an equal volume of 2X RNA Loading Dye. If using a non ready-to-use version of the RNA ladder, mix it with the loading dye solution as well. Use 0.25 µl of conventional ladder per 1 mm of the gel lane width.
- Heat samples and ladder for 10 min at 70°C.
- Chill samples and ladder on ice for 3 min and spin briefly prior to loading.
- Load 1 µl of sample per 1 mm of gel lane width.
- Run the RNA ladder in parallel with your samples. Use 0.5 µl of the ready-to-use ladder per 1 mm of gel lane width.
- Run the gel at 5 V/cm.
- High Yield in vitro Transcription using the TranscriptAid™ T7 High Yield Transcription Kit
- Protocol for generation of unlabeled and high specificity non-radiolabeled RNA transcripts from DNA templates containing a T7 RNA Polymerase promoter using the TranscriptAid™ T7 High Yield Transcription Kit, in pdf (101 KB).
DNA/RNA 5', 3'-end Labeling
- DNA 5'-end Labeling by T4 Polynucleotide Kinase in the Exchange Reaction
- All types of DNA ends can be successfully labeled with T4 Polynucleotide Kinase. However, the labeling efficiency is greatest for the 5'-protruding DNA ends, lower for blunt ends, and is the lowest for 5'-recessed DNA ends.
- This protocol is recommended for radiolabeling of DNA markers and ladders. (Ready-to-use versions with the loading dye pre-added are not suitable for labeling).
- Prepare the following reaction mixture:
| digested DNA | 1-20 pmol of 5'-termini | | 10X reaction buffer B for T4 Polynucleotide Kinase | 2 µl | | [gamma-32P or gamma-33P]-ATP | 40 pmol | | 24% (w/v) PEG 6000 solution | 4 µl | | Water, nuclease-free | to 19 µl | | T4 Polynucleotide Kinase | 1 µl (10 u) | | Total volume | 20 µl | - Incubate at 37°C for 30 min.
- Add 1 µl 0.5 M EDTA, pH 8.0 and heat at 75°C for 10 min.
- Separate labeled DNA from unincorporated label by gel filtration on Sephadex G-50.
Note - If an ethanol solution of [gamma-32P or gamma-33P]-ATP is used, dry the required amount of ATP under vacuum and dissolve in Water, nuclease-free (#R0581).
- The ATP concentration should be at least 2 µM in the exchange reaction (1, 2).
- For estimation of pmol of DNA ends, see REviewer™.
References - Sambrook, J., Russell, D.W., Molecular Cloning: A Laboratory Manual, the Third edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 2001.
- Current Protocols in Molecular Biology, vol. 1 (Ausubel, F.M., et al., ed.), John Wiley & Sons, Inc., Brooklyn, New York, 3.10.2-3.10.5, 1994-2004.
- DNA/RNA 5'-end Labeling by T4 Polynucleotide Kinase in the Forward Reaction
- Prepare the following reaction mixture:
Dephospharylated DNA or Oligonucleotide | 1-20 pmol of 5'-termini 10-50 pmol | | 10X reaction buffer A for T4 Polynucleotide Kinase | 2 µl | | [gamma-32P or gamma-33P]-ATP | 20 pmol | | Water, nuclease-free | to 19 µl | | T4 Polynucleotide Kinase | 1 µl (10 u) | | Total volume | 20 µl | - Incubate at 37°C for 30 min.
- Add 1 µl 0.5 M EDTA, pH 8.0 and heat at 75°C for 10 min.
- Separate labeled DNA from unincorporated label by gel filtration on Sephadex G-50.
Note - If an ethanol solution of [gamma-32P or gamma-33P]-ATP is used, dry the required amount of ATP under vacuum and dissolve in Water, nuclease-free.
- The ATP concentration should be at least 1 µM in the forward reaction (1, 2).
- For estimation of pmol of DNA ends, see REviewer™.
References - Sambrook, J., Russell, D.W., Molecular Cloning: A Laboratory Manual, the Third edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 2001.
- Current Protocols in Molecular Biology, vol. 1 (Ausubel, F.M., et al., ed.), John Wiley & Sons, Inc., Brooklyn, New York, 3.10.2-3.10.5, 1994-2004.
- Radioactive Labeling of RiboRuler™ RNA Ladders by T4 Polynucleotide Kinase
- The ready-to-use versions of RiboRuler™ RNA ladders can not be radiolabeled with T4 Polynucleotide Kinase.
For efficient labeling of RNA ladders it is recommended to remove 5'-phosphate groups from RNA and then phosphorylate in forward reaction using T4 Polynucleotide Kinase.
I. Dephosphorylation
- Prepare the following reaction mixture:
RiboRuler™ Low Range RNA Ladder or RiboRuler™ High Range RNA Ladder |
8 µl |
| RiboLock™ RNase Inhibitor |
0.5 µl (20 u) |
| 10X reaction buffer for alkaline phosphatase |
2 µl |
FastAP™ Thermosensitive Alkaline Phosphatase or Shrimp Alkaline Phosphatase |
2 µl (2 u) |
| DEPC-treated Water |
to 20 µl |
| Total volume |
20 µl |
- Incubate at 37°C for 30 minutes.
- Remove proteins from the mixture with a 20 µl aliquot of Tris-saturated (pH 8.0) phenol and chloroform mixture. Save the upper aqueous phase and extract it twice with 20 µl aliquot of chloroform.
- Precipitate RNA by adding 1 µl of 3 M Sodium Acetate Solution, 55 µl of 96% ethanol and keep 15-30 min at -20°C. Centrifuge the mixture for 20 min at 10,000-15,000 rpm at 4°C.
- Rinse the pellet with 20 µl cold 75% ethanol. Centrifuge 10 min at 10,000-15,000 rpm, 4°C.
- Discard the supernatant and dissolve the air-dried pellet in 10 µl of DEPC-treated Water.
II. Labeling
- Prepare the following reaction mixture:
Dephosphorylated RiboRuler™ Low Range RNA Ladder or Dephosphorylated RiboRuler™ High Range RNA Ladder |
1 µl 2.5 µl |
| [gamma-32P]-ATP (5000 Ci/mmol,10 µCi/µl)* |
5 µl (10 pmol) |
| RiboLock™ RNase Inhibitor |
0.25 µl (10 u) |
| 10X buffer A for forward reaction (supplied with T4 polynucleotide kinase) |
1 µl |
| T4 Polynucleotide Kinase |
1 µl (10 u) |
| DEPC-treated Water |
to 10 µl |
| Total volume |
10 µl |
* If [gamma-32P]-ATP with a high specific activity (higher than 5000 Ci/mmol) is used, the label can be diluted with ATP. Total ATP concentration should be at least 1 µM.
- Incubate at 37°C for 30 minutes.
- Stop the reaction by adding 1 µl of 0.5 M EDTA, pH 8.0 and extract the mixture with an equal volume of chloroform.
- Determine the efficiency of label incorporation.
- Load the ladder on the gel.
- DNA 3'-end Labeling by Fill-in of 5'-overhangs with Klenow Fragment* or Bsm DNA Polymerase, Large Fragment
- Prepare the following reaction mixture:
| Linear DNA (aqueous solution) | 0.1-4 µg | 10X reaction buffer for Klenow Fragment or 10X Bsm buffer | 2 µl | [alpha-32P]-dNTP, ~15-30 TBq/mmol (400-800 Ci/mmol) or [alpha-32P]-dNTP, ~110 TBq/mmol (3000 Ci/mmol) | 0.74 MBq (20 µCi) 2.96 MBq (80 µCi) | | 3 dNTP Mix, 2 mM each (without a labeled dNTP) | 2.5 µl (0.25 mM final concentration) | Klenow Fragment or Klenow Fragment, exo- or Bsm DNA Polymerase, Large Fragment | 0.1 µl (1 u) 0.2 µl (1 u) 0.125 µl (1 u) | | Water, nuclease-free | to 20 µl | | Total volume | 20 µl | - Incubate at 37°C for 15 min.
- Stop the reaction by heating at 75°C for 10 min.
Note * This protocol is suitable labeling of the following Fermentas DNA markers, composed of DNA fragments with 5'-overhangs: Lambda DNA EcoRI Marker, #SM028 Lambda DNA HindIII Marker, #SM0101 Lambda DNA EcoRI/HindIII Marker, #SM0191 Lambda DNA Eco91I Marker, #SM0111 phiX174 DNA HinfI Marker, #SM0261 - The modified version of this protocol can be used for non-radioactive labeling of DNA markers. Substitute a part of dTTP nucleotide with a modified nucleotide (e.g. Biotin-11-dUTP or Fluorescein-12-dUTP) at a molar ratio of 1:2.
- For estimation of pmol of DNA ends, see REviewer™.
- DNA and Oligonucleotide 3'-end Labeling by Tailing with Terminal Deoxynucleotidyl Transferase
- Prepare the following reaction mixture:
| 5X reaction buffer for Terminal Deoxynucleotidyl Transferase |
10 µl |
| Linear DNA |
10 pmol |
| [alpha-32P]-ddATP, ~110 TBq/mmol (3000 Ci/mmol) |
1.85 MBq (50 µCi) |
| Terminal Deoxynucleotidyl Transferase |
2 µl (40 u) |
| Water, nuclease-free |
to 50 µl |
| Total volume |
50 µl |
- Incubate at 37°C for 15 min.
- Stop the reaction by heating at 70°C for 10 min or by the addition of 5 µl 0.5 M EDTA.
NoteThe efficiency of the reaction depends upon the type of 3'-OH termini of the DNA fragments. 3'-protruding ends are labeled with higher efficiency than recessed or blunt ends.
- RNA 3'-end Labeling by Ligation
- Prepare the following in a single RNase-free microfuge tube:
| 10X ligation buffer for T4 RNA Ligase |
2 µl |
| 10 mM ATP |
1 µl |
| RNA |
50-100 pmol |
| [32P]-pCp |
50-100 pmol (equimolar amount) |
| T4 RNA Ligase |
1 µl (10 u) |
| DEPC-treated Water |
to 20 µl |
| Total volume |
20 µl |
- Incubate at 4°C for 10-12 hours (overnight).
- Separate labeled RNA from unincorporated label by gel filtration on Sephadex G-50.
Random-Primed Labeling
- Radioactive Random-primed DNA Labeling with Klenow Fragment, exo- or Bsm DNA Polymerase, Large Fragment
- Prepare the following reaction mixture:
| DNA (aqueous solution) |
10 µl (100 ng) |
10X reaction buffer for Klenow Fragment, exo- or 10X Bsm buffer |
5 µl |
| 6.0 A260units/ml (100 µM) Random Hexamer Primer |
12.5 µl |
| Water, nuclease-free |
to 40 µl |
| Total volume |
40 µl |
- Incubate the mixture in a boiling water bath for 5-10 minutes and then chill on ice.
- Add:
| 3 dNTP Mix, 0.33 mM each (without a labeled dNTP) |
3 µl (0.02 mM final concentration) |
| [alpha-32P]-dNTP, ~110 TBq/mmol (3000 Ci/mmol) |
1.85 MBq (50 µCi) |
Klenow Fragment, exo- or Bsm DNA Polymerase, Large Fragment |
1 µl (5 u) 1 µl (8 u)
|
| Water, nuclease-free |
to 50 µl
|
| Total volume |
50 µl |
- Incubate the reaction mixture for 10 minutes at 37°C.
- Add 4 µl 0.25 mM dNTP mix and incubate at 37°C for 5 minutes.
- Add 1 µl 0.5 M EDTA, pH 8.0 to stop the reaction.
- Remove 1 µl of the reaction mixture and determine the percentage of label incorporated.
- Purify by using Sephadex G-50 or Bio-Gel P-60.
- Non-radioactive Random-primed DNA Labeling with Klenow Fragment, exo-
- Prepare the following reaction mixture:
| DNA template |
10 µl (100 ng – 1 µg) |
| 10X reaction buffer for Klenow Fragment, exo- |
5 µl |
| 6.0 A260units/ml (100 µM) Random Hexamer Primer |
12.5 µl |
| Water, nuclease-free |
to 39 µl |
| Total volume |
39 µl |
- Incubate the mixture in a boiling water bath for 5-10 minutes and then chill on ice.
- Add:
| 3 dNTP Mix, 1 mM each (without the dTTP) |
5 µl (0.1 mM final concentration) |
| dTTP |
3.25 µl (0.065 mM final conc.) |
| Biotin-11-dUTP*, 1 mM |
1.75 µl |
| Klenow Fragment, exo- |
1 µl (5 u) |
| Total volume |
50 µl |
* Fluorescein-12-dUTP, DIG-dUTP or Aminoallyl-dUTP can also be used with the same protocol.
- Incubate the reaction mixture at 37°C for 1 hour.
- Add 1 µl 0.5 M EDTA, pH 8.0 to stop the reaction.
- Remove 1 µl of the reaction mixture and determine the percentage of label incorporated.
- Optionally, purify by using Sephadex G-50 or Bio-Gel P-60.
- Radioactive random-primed DNA labeling using the DecaLabel™ DNA Labeling Kit
- Protocol for fast synthesis of radiolabeled DNA probes of high specific activity using the DecaLabel™ DNA Labeling Kit, in pdf (121 KB).
- Non-radioactive random-primed DNA labeling using the Biotin DecaLabel™ DNA Labeling Kit
- Protocol for efficient synthesis of biotin-labeled DNA probes, based on improved random-primed labeling method using the Biotin DecaLabel™ DNA Labeling Kit, in pdf (107 KB).
DNA Labeling by Nick-Translation
- Radioactive and Non-radioactive DNA Labeling by Nick-translation
I. Radioactive DNA labeling by nick-translation
- Mix the following components:
| 10X reaction buffer for DNA Polymerase I |
2.5 µl |
| Mixture of 3 dNTPs, 1 mM* (without the labeled dNTP) |
1.25 µl |
| [alpha-32P]-dNTP, ~110 TBq/mmol (3000 Ci/mmol) |
1.85-3.7 MBq (50-100 µCi) |
| DNase I, RNase-free freshly diluted to 0.002 u/µl** |
1 µl |
| DNA Polymerase I |
0.5-1.5 µl (5-15 u) |
| Template DNA |
0.25 µg |
| Water, nuclease-free |
to 25 µl |
| Total volume |
25 µl |
- Immediately incubate at 15°C for 15-60 minutes.
- Terminate the reaction by adding 1µl of 0.5 M EDTA, pH 8.0.
- Take an aliquot (1 µl) to determin the efficiency of the label incorporation. A specific activity of DNA at least 108 cpm/µg DNA is expected.
- If needed, the labeled DNA may be separated from the unincorporated radioactive precursors on Sephadex G-50 or Bio-Gel P-60 column or using spin column (e.g. GeneJET™ PCR Purification Kit (#K0701).
Note
* To prepare a mixture of three non-labeled dNTPs (1 mM of each), mix 1 µl aliquots of stock solutions of each dNTP (100 mM, from #R0181) with 97 µl of Water, nuclease-free. These dNTP mixes can be stored at -20°C for further use. ** The DNase I, RNase-free can be diluted with the 1X reaction buffer for DNA Polymerase I.
- The reaction volumes can be scaled up or down providing that the final concentrations of the components (DNA, dNTPs, labeled dNTP) are as indicated in the protocol.
- Radioactive DNA probes with higher specific activities can be prepared using two radioactively labeled dNTPs simultaneously. In this case, the composition of the unlabeled dNTP mix should be adjusted accordingly.
II. Non-radioactive DNA labeling by nick-translation
The protocol above can be used for non-radioactive labeling by nick-translation using biotin-11-dUTP, fluorescein-12-dUTP, DIG-dUTP or aminoallyl-dUTP: - normal dTTP is subsituted for labeled-dUTP at
a molar ratio of 1:3-1:5,
- reaction time is prolonged to 1-2 hours.
RNA Labeling by in vitro Transcription
- Synthesis of Radiolabeled RNA Probes of High Specific Activity
- Linearize template DNA with a restriction enzyme. Extract DNA with phenol/chloroform, then with chloroform/isoamyl alcohol, and precipitate with ethanol. Dissolve DNA in DEPC-treated Water.
- Combine the following reaction components at room temperature in the order given:
| DEPC-treated Water |
to 20 µl |
| 5X transcription buffer for RNA Polymerase |
4 µl |
| 3 NTP Mix, 10 mM each* (without labeled NTP) |
1 µl (0.5 mM final concentration) |
| 100 µM CTP |
2.4 µl (12 µM final concentration) |
| [alpha-32P]-CTP, ~30 TBq/mmol (800 Ci/mmol) |
1.85 MBq (50 µCi) |
| Linearized template DNA |
0.2-1.0 µg |
| RiboLock™ RNase Inhibitor |
0.5 µl (20 u) |
T7 RNA Polymerase or SP6 RNA Polymerase or T3 RNA Polymerase |
1 µl (20 u) |
| Total volume |
20 µl |
- Incubate at 37°C for 2 hours.
- Stop the reaction by cooling at -20°C.
- Determine the percentage of the label incorporated into RNA.
Note
* To prepare a mix of the three non-labeled NTPs, 10 mM each, combine 1 µl of all three NTPs, 100 mM, from the set (#R0481) with 7 µl of DEPC-treated Water. Store the mix at -20°C for further use.
- Expect specific radioactivity of 3-5 x108 dpm/µg.
- RNA can be radiolabeled with [32P], [35S] or [3H]-ribonucleotides. Recommended amounts of radiolabeled nucleotides in 20 µl of reaction mixture are as follows:
1.85 MBq (50 µCi) for 5'-[alpha-32P]-CTP, approx. 30 TBq/mmol (800 Ci/mmol); 11.1 MBq (300 µCi) for 5'-[alpha-35S]-UTP, more than 37 TBq/mmol (1000 Ci/mmol); 0.925 MBq (25 µCi) for 5,6-[3H]-UTP, 1.1-2.2 TBq/mmol (30-60 Ci/mmol).
- The yield of the full-length transcripts is reduced when the concentration of labeled NTP is below 12 µM.
cDNA Labeling by Reverse Transcription
- Synthesis of cDNA Probes with High Specific Radioactivity and Non-radioactively Labeled cDNA
-
I. Synthesis of cDNA probes with high specific radioactivity
- This protocol is provided for first strand cDNA synthesis using RevertAid™ H Minus Reverse Transcriptase. For specific reaction conditions using other enzymes, see Table below. Enzyme units and RNA amounts are provided for 20 µl of RT reaction volume:
| Reverse transcriptase |
Reaction tmp. |
Active up to |
Reading length |
RHase H activity |
Inactivation |
Units |
Total RNA |
poly(A) RNA |
| Maxima® RT |
50-55°C |
60°C |
20kb |
+ |
85°C, 5min |
200 |
1pg-5µg |
0.1pg-500ng |
| RevertAid™ Premium RT |
50-55°C |
60°C |
20kb |
– |
85°C, 5min |
200 |
1pg-5µg |
0.1pg-500ng |
| RevertAid™ H Minus RT |
42-45°C |
55°C |
13 kb |
– |
70°C, 10min |
200 |
0.1ng-5µg |
10pg-500ng |
| RevertAid™ RT |
42°C |
50°C |
13kb |
+ |
70°C, 10min |
200 | 0.1ng-5µg |
10pg-500ng |
| M-MuLV RT |
37°C |
37°C |
9kb |
+ |
70°C, 10min |
40 |
100ng-5µg |
10-500ng |
|
AMV RT |
45-60°C | 60°C |
13kb |
++ |
85°C, 5min |
10 |
10ng-5µg |
1-100ng |
- Mix and briefly centrifuge all components after thawing, keep on ce.
- Add into sterile, nuclease-free tube on ice in the order given:
| Template RNA |
Total RNA or |
up to 5 µg |
| Poly(A) RNA or |
up to 500 ng |
| Specific RNA or |
up to 500 ng |
| Primers |
Oligo(dT)18 or |
0.5 µg (100 pmol) |
| Random Hexamer |
0.2 µg (100 pmol) |
| Gene-specific |
15-20 pmol |
| DEPC-treated Water |
to 8.5 µl |
| Total volume |
8.5 µl |
- Mix gently and centrifuge to collect all drops.
Optional. Incubate at 65°C for 5 min, chill on ice and briefly centrifuge to collect drops. Perform this step if RNA template is GC-rich or is known to contain secondary structures. - Place the tube with primer/template mix on ice and add the following components in the indicated order:
5X reaction buffer| 4 µl | | | RiboLock™ RNase Inhibitor | 0.5 µl (20 u) | | dGTP, dCTP, dTTP mix, 10 mM each | 1 µl | 0.1 mM dATP| 4 µl | | | [alpha-32P]-dATP, 3000 Ci/mmol | 1 µl | | RevertAid™ H Minus Reverse Transcriptase | 1 µl (200 u) | | Total volume | 20 µl |
|---|
- Mix gently and centrifuge to collect all drops.
- If Oligo(dT)18 primer or gene-specific primer is used, incubate 60 min at 42°C. If random hexamer primer is used, incubate 10 min at 25°C followed by 60 min at 42°C. For transcription of GC-rich RNA reaction temperature can be increased to 45°C.
- Stop the reaction by adding 5 µl of 0.5 M EDTA, pH 8.0.
Optional. Hydrolyze RNA by the addition of equal volume (25 µl) of 0.6 M NaOH and incubation at 70°C for 30 min. - Remove unincorporated dNTPs by chromatography on a Sephadex® G-50 column.
- Expect specific radioactivity of >107 dpm/µg.
Note- To achieve higher specific activities (over 108 dpm/µg), use up to 100 µCi of [alpha-32P]-dATP in the labeling mixture. To keep the total reaction volume of 20 µl, vacuum-evaporate 10 µl of [alpha-32P]-dATP (10 mCi/ml) to 1 µl in a separate tube.
II. Synthesis of non-radioactively labeled cDNA
The same protocol can be used for synthesis of non-radioactive labeled cDNA using biotin-11-dUTP, fluorescein-12-dUTP, DIG-dUTP or aminoallyl-dUTP: - normal dTTP is subsituted with labeled-dUTP at a molar ratio of 1:3-1:4,
- reaction time is prolonged to 2-6 hours.
Blotting, Molecular Detection
- Southern Blotting. Dot Blotting
- Required solutions
- Denaturation solution: 1.5 M NaCl, 0.5 M NaOH.
- Neutralization solution: 1.5 M NaCl, 0.5 M Tris-HCl (pH 7.2), 1 mM EDTA.
- 20X SSC, pH 7.0 (blotting buffer): 3 M NaCl, 0.3 M sodium citrate, 1 mM EDTA.
- 100X Denhardt\'s solution: 2% (w/v) BSA, 2% (w/v) Ficoll™, 2% (w/v) PVP (polyvinylpyrrolidone).
- Pre-hybridization solution: 6X SSC, 5X Denhardt's solution, 50% formamide, 0.5% SDS.
Electrophoresis
Load genomic DNA probes along with the marker (e.g. DNA Markers for Genomic DNA analysis) on 0.7% agarose gel (20 cm length). Run for 18 hours at 3 V/cm in 1X TAE buffer.
Southern Blotting
- Rinse the gel in deionized water, add Denaturation solution and shake for 30 min at room temperature. Rinse the gel in deionized water and add Neutralization solution. Shake for 15 min at room temperature. Repeat neutralization procedure.
- Fill the glass dish with 20X SSC blotting buffer. Make a platform and cover it with a sheet of Whatman™ 3 MM filter paper, saturated with the blotting buffer (see picture below).
- Place the gel upside down on the filter and avoid trapping air bubbles beneath it.
- Cut a sheet of SensiBlot™ Plus Nylon Membrane to match the size of the gel and place it on the top of the gel. Avoid trapping air bubbles beneath the membrane.
- Cut 2-3 sheets of Whatman™ 3 MM filter paper to the size, wet with blotting buffer and place on the top of the membrane.
- Place a stack of absorbent paper towels on top of the 3 MM paper, place a glass plate on the top of the paper towels and put a 0.5 kg weight on the top.
- Allow upward capillary transfer of DNA at room temperature for 18 hours.
- Wash the membrane in 2X SSC buffer to remove any residual agarose, dry at room temperature and fix for 2 min under UV-light.
Dot Blotting
- Prepare several dilutions of the labeled probe (from 1 ng/µl to 10 fg/µl) and spot 1 µl of each dilution onto a nylon membrane strip.
- Air-dry the spotted membrane at room temperature for 30-45 minutes or at 80°C for 10 minutes.
- Place the membrane on a UV trans-illuminator (spotted side down) and cross link the probe to the membrane for 1-5 minutes.
Note
The spotted membrane can be stored at 4°C or at room temperature in a plastic bag until needed.
Generation of Labeled Probes
Two labeled probes are prepared using Biotin DecaLabel™ DNA Labeling Kit, DecaLabel™ DNA Labeling Kit or using protocol for random-primed labeling.
- Hybridization probe for the genomic DNA (test probe).
- Hybridization probe for visualization of DNA Marker (e.g. DNA Markers for Genomic DNA analysis). 50 ng of marker is sufficient for generation of radioactively labeled probe for 3-5 hybridization reactions.
Hybridization
- Prepare 30 ml of the pre-hybridization solution.
- Denature sonicated salmon sperm DNA solution (10 mg/ml) by heating at 100°C for 5 min. Chill on ice and add to the pre-hybridization solution to a final concentration of 50-100 µg/ml.
- Place the membrane into the hybridization container, add pre-hybridization solution with the denatured salmon sperm DNA (0.2 ml/cm2 of membrane) and pre-hybridize for 2 hours at 42°C with shaking.
- Prepare the hybridization solution:
- mix the two prepared probes: labeled probe for the DNA marker and probe for genomic DNA. Denature by heating at 100°C for 5 min and chill immediately on ice.
- Add the following amounts of the probe mixture to the pre-hybridization solution:
- to 10 ng/ml (1/5 of probe mix) if specific activity is 108 dpm/µg,
- to 2 ng/ml (1/25 of probe mix) if specific activity is 109 dpm/µg,
- to 25-100 ng/ml if non-radioactively labeled probes.
- Discard the pre-hybridization solution (from step 3) and add the prepared hybridization solution to the hybridization bag (60 µl/cm2). Incubate for at least 12 hours at 42°C.
- Carry out the following washes of the membrane:
- twice in 2X SSC + 0.1% SDS for 10 min at room temperature,
- twice in 0.1X SSC + 0.1% SDS for 10 min at 65°C (for high stringency).
- Dry the membrane using sheets of Whatman™ 3 MM paper.
Autoradiography
Wrap the dried membrane with Saran Wrap™ and expose to a phosphoimager or a film with an intensifying screen.
 Figure. Upward capillary transfer of DNA from agarose gels.
- Biotin detection using the Biotin Chromogenic Detection Kit
- Protocol for chromogenic detection of biotinylated nucleic acid probes using the Biotin Chromogenic Detection Kit, in pdf (60 KB).
Protein Electrophoresis & Analysis
- General Recommendations for SDS-PAGE
- Low percentage gels are recommended for analysis of large proteins and high percentage gels for analysis of small proteins.
- Linear gradient gels allow for high resolution of a broad range of both small and large proteins.
Gel Recommendations.
| Protein MW range, kDa |
Recommended gel, % |
| ~5-50 |
18 |
| ~5-60 |
16 |
| ~10-80 |
14 |
| ~20-150 |
12 |
| ~30-200 |
10 |
| ~40-250 |
8 |
| ~60-300 |
6 |
| ~100-400 |
4 |
| Protein MW range, kDa |
Recommended gradient gel, % |
| ~5-100 |
10-20 |
| ~5-300 |
4-20 |
| ~10-200 |
8-16 |
| ~30-300 |
4-12 |
- All Fermentas protein ladders/markers can be used on 6, 8, 10, 12, 14 % SDS polyacrylamide gels and on 4-12%, 8-16%, 4-20% and 10-20% gradient gels.
- The following general rule can be applied to protein ladders/markers as well as to protein samples:
- in low percentage gels (4-8%), small proteins (10-15 kDa) migrate with the tracking dyes during electrophoresis and may be not visible;
- in high percentage gels (14-18%) large proteins (150-250 kDa) may not separate.
- For more precise determination of molecular weights, unstained protein ladders/markers are recommended.
- Prestained standards are ideal for monitoring the process of electrophoresis and the protein transfer efficiency in Western blotting.
- Prestained proteins may have different mobilities in various SDS-PAGE buffer and gel systems due to coupled chromophores that affect protein mobility. Prestained standards are recommended when approximate sizing is enough.
- Each lot of prestained protein ladder/marker is calibrated against a precisely sized unstained protein ladder/marker in Tris-glycine-SDS gel and the calculated apparent molecular weights are reported in the product's Certificate of Analysis. The prestained protein may have different mobility in other electrophoresis buffer and gel systems.
- Modifications to native proteins such as phosphorylation and glycosylation may alter protein mobility. The molecular weights of modified proteins may not correspond to those of unmodified proteins of the same size.
- Protein Ladder/Marker: Recommendations for Loading
- Thaw the ladder either at room temperature or at 37°C for a few minutes to dissolve precipitated solids. Do not boil.
- Mix gently, but thoroughly, to ensure that the solution is homogeneous.
- For Unstained Protein Molecular Weight Marker only:
- transfer the required aliquot to a clean tube with a screw cap;
- heat at 95°C for 10 minutes;
- cool and mix.
Once denatured the marker can be further used just after the thawing.
- Load the following volumes of the ladder/marker on SDS-polyacrylamide gel with a thickness of 0.75 mm:
- 5 µl per well for mini-gels;
- 10 µl per well for large gels.
For Spectra™ Multicolor Broad Range Protein Ladder:
- 10 µl per well for mini-gels;
- 20 µl per well for large gels.
Note
- To avoid overloading the gel which will be subsequently silver stained, dilute the ladder/marker just prior to use:
Water, nuclease-free: 36.5 µl 5X Protein Loading Buffer*: 10 µl 20X Reducing Agent (#R0891): 2.5 µl Protein ladder/marker: 1 µl
- * Alternatively 4X DualColor™ Protein Buffer Loading Pack can be used. Volumes of the buffer and water should be adjusted appropriately.
- Staining is not required to visualize prestained protein ladders/markers.
To visualize unstained protein ladders/markers, the gel can be processed with PageBlue™ Protein Staining Solution, PageSilver™ Silver Staining Kit or other protein staining techniques. For silver staining, the volume of Unstained Protein Molecular Weight Marker used should be decreased up to 10-fold.
- Protein Samples: Extraction and Quantification Guides
| Sample/procedure |
Extraction |
Quantification |
| Mammalian cell and tissue samples |
Extract total proteins using ProteoJET™ Mammalian Cell Lysis Reagent. Extract nuclear and cytoplasmic proteins using ProteoJET™ Cytoplasmic and Nuclear Protein Extraction Kit.
|
- Use Bradford Reagent, ready-to-use for protein quantification.
- Easily create standard curves by using one of our convenient protein standard sets:
- Bovine Serum Albumin Standard Set,
- Bovine Gamma Globulin Standard Set,
- Protein Standard Solution.
- Create a standard curve by plotting the 595 nm values (y-axis) versus their concentration in µg/ml (x-axis).
- Use the standard curve to determine the protein concentration of each unknown sample.
|
| Bacterial samples |
To analyze total bacterial proteins in SDS-PAGE, cells can be treated directly with DualColor™ Protein Loading Buffer Pack or Protein Loading Buffer Pack. |
| Lyophilized proteins |
To analyze proteins in SDS-PAGE, treat lyophilized proteins directly with DualColor™ Protein Loading Buffer Pack or Protein Loading Buffer Pack. |
- Protein Samples: Preparation for Loading on SDS-PAGE
| Step |
Sample preparation with the DualColor™ Protein Loading Buffer Pack |
Sample preparation with the Protein Loading Buffer Pack
|
| Thaw |
Thaw the buffer pack components either at room temperature or at 37°C for a few minutes to dissolve precipitates. |
| Mix |
Vortex gently, but thoroughly to ensure that the solution is homogeneous. |
| Dilution |
2.0 µl of 20X Reducing Agent | 2.5 µl of 20X Reducing Agent |
Protein sample (~0.5 ng – 2.5 µg) For Western blots or gels to be treated with Coomassie based stains, use up to 2.5 µg of total protein per minigel well. For silver staining applications use up to 10 ng of total protein per minigel well. |
10 µl of 4X DualColor™ Protein Loading Buffer Water, nuclease-free to 40 µl* |
10 µl of 5X Protein Loading Buffer Water, nuclease-free to 50 µl* |
| Denaturation |
Incubate samples at 95-100°C for 5 minutes. |
| Loading |
Spin for a few seconds in a microcentrifuge. Apply directly to an SDS-polyacrylamide gel. Use ~10 µl per minigel well. |
* The sample volume can be scaled up or down.
- General Protocol for SDS-PAGE
- I. Reagents
30% acrylamide/bisacrylamide (37.5:1) aqueous solution (stored in the dark) 1.5 M Tris-HCl buffer (pH 8.8) 0.5 M Tris-HCl buffer (pH 6.8) 10% ammonium persulfate (APS) solution (always should be prepared freshly) TEMED 1X Tris-glycine-SDS Buffer (10X buffer diluted to 1X concentration prior use) Caution. Acrylamide is a neurotoxin. Always wear gloves, safety glasses, and a surgical mask when working with acrylamide powder. II. Resolving Gel Preparation
| Components |
Volume: 10 ml resolving gel solution (for 2 minigels) |
| for 8% gel |
for 10% gel |
for 12% gel |
| Deionized water |
4.73 ml |
4.13 ml |
3.43 ml |
| 30% acrylamide/bisacrylamide |
2.7 ml |
3.3 ml |
4.0 ml |
1.5 M Tris-HCl containing 0.4% SDS, pH 8.8 |
2.5 ml |
2.5 ml |
2.5 ml |
| 10% APS |
60 µl |
60 µl |
60 µl |
| TEMED |
13 µl |
13 µl |
13 µl |
III. Stacking Gel Preparation
| Components |
Volume: 5 ml stacking gel solution (for 2 minigels) |
| Deionized water |
3.0 ml |
| 30% acrylamide/bisacrylamide |
700 µl |
0.5 M Tris-HCl containing 0.4% SDS, pH 6.8 |
1.25 ml |
| 10% APS |
25 µl |
| TEMED |
20 µl |
IV. Procedure
- Assemble the glass plate sandwich. Prepare the resolving gel solution as described above.
- Add APS and TEMED last, mix carefully to avoid formation of bubbles.
- Important Note. Polymerization begins as soon as APS is added to the mixture, so all subsequent actions must be performed promptly.
- Pour the gel solution between the glass plates with a pipette, leave about 1/4 of the space free for the stacking gel. Carefully cover the top of the resolving gel with 50% isopropanol, 0.1% SDS solution or water, and wait until the resolving gel polymerizes (~30 min). A clear line will appear between the gel surface and the solution on top when polymerization is complete.
- Discard the water, isopropanol or SDS solution. Wash gently with double-distilled water.
- Pour the stacking gel solution (prepared as described above, add APS and TEMED last) carefully with a pipette to avoid formation of bubbles.
Important Note. Polymerization begins as soon as APS is added to the mixture, so all subsequent actions must be performed promptly.
- Insert combs. Allow the gel to polymerize for at least 60 min.
- Remove combs carefully. Put the gel into the electrophoresis tank, fill the tank (bottom and top reservoirs) with fresh 1X Tris-glycine-SDS Buffer, make sure that the gel wells are covered with the buffer.
- Load protein ladder/marker and probes.
- Set an appropriate voltage and current depending on how many gels you run. Increase the power when the dye front reaches the running gel. For exact values refer to the table below:
| Gel |
1 minigel |
2 minigels |
| Stacking gel (upper) |
13 mA |
25 mA |
| Resolving gel (lower) |
25 mA |
50 mA |
Values presented are for 0.75 mm gels. For thicker gels the current should be appropriately increased.
- Stop the electrophoresis run when the dye front reaches the bottom of the gel. Disassemble the gel sandwich and proceed with gel staining or Western blot procedures.
- Gel Staining Procedure with PageBlue™ Protein Staining Solution
| With microwaving (fast protocol) |
Without microwaving (conventional protocol) |
| Total time |
25 min for native gels 40 min for SDS-containing gels |
65 min for native gels 95 min for SDS-containing gels |
| 1. Washing in water*. Repeat 3 times |
- Add 100 ml water
- Microwave for 1 min
- Wash with gentle agitation for 5 min
- Discard the water
|
- Add 100 ml water and rinse
- Discard the water
|
| 2. Staining |
- Add 20 ml PageBlue™ Protein Stainin Solution
- Microwave for 30 s
- Stain with gentle agitation for 20 min
- Discard the solution
|
- Add 20 ml PageBlue™ Protein Staining Solution
- Stain with gentle agitation for 60 min (or overnight)
- Discard the solution
|
| 3. Washing in water |
- Add 100 ml water and rinse for 5 min
|
- Add 100 ml water and rinse for 5 min
|
* only SDS-containing gels
Note
- PageBlue™ Protein Staining Solution can be reused up to 3 times without a decrease in sensitivity.
- All reagent volumes are for 8x10 or 10x10 cm minigels of 0.75-1 mm thickness. Gels should be completely immersed in solution.
- When several gels are being stained, increase the amount of staining solution accordingly.
- The first wash step is crucial to remove SDS from the gel as SDS interferes with the staining reaction.
- For staining native gels without SDS, the washing step is not required.
- Staining sensitivity can be increased if the proteins are fixed for 15 min either with 12% trichloracetic acid or with 25% isopropanol supplemented with 10% acetic acid. Fixation prevents protein diffusion from the gel and accelerates SDS removal. After fixation, gels can be stained immediately without additional washing.
- Using either the fast or conventional protocol, staining sensitivity is 5 ng of protein per band. To increase sensitivity to 0.05 ng per band the gel can be stained using the PageSilver™ Silver Staining Kit.
- For staining peptides or small proteins (more than 10 kDa) fixation of the proteins for 15 min either with 12% trichloracetic acid or with 25% isopropanol supplemented with 10% acetic acid is recommended. Fixation prevents protein diffusion from the gel and accelerates SDS removal. After fixation, gels can be stained immediately without additional washing. Overnight staining time is required for peptide detection.
- Gel Staining Procedure with PageSilver™ Silver Staining Kit
| With microwaving (fast protocol) |
Without microwaving (conventional protocol) |
Total time Sensitivity |
1 hour 0.1 ng/band |
2 hours 40 min 0.05 ng/band |
| 1. Gel fixing 1 |
- Rinse the gel with deionized water
- Add gel fixing solution 1
- Microwave for 30 s. Do not boil
- Fix with gentle agitation for 10 min
- Discard the solution
|
- Rinse the gel with deionized water
- Add gel fixing solution 1 and gently agitate for 60 min
- Discard the solution
|
| 2. Gel fixing 2 and Washing |
Perform Gel fixing 2 procedure twice:
- Add gel fixing solution 2
- Microwave for 30 s. Do not boil
- Fix with gentle agitation for 10 min
- Discard the solution
Perform Washing procedure twice: - Add deionized water and gently agitate for 20 s
- Discard the water
|
Perform Gel fixing 2 procedure three times:
- Add gel fixing solution 2 and gently agitate for 20 min
- Discard the solution
Perform Washing procedure twice: - Add deionized water and gently agitate for 20 s
- Discard the water
|
| 3. Sensitizing and Washing |
- Add sensitizing solution and gently agitate for 1 min
- Discard the solution
Perform Washing procedure twice: - Add deionized water and gently agitate for 20 s
- Discard the water
|
- Add sensitizing solution and gently agitate for 1 min
- Discard the solution
Perform Washing procedure twice: - Add deionized water and gently agitate for 20 s
- Discard the water
|
| 4. Staining and Washing |
- Add staining solution and gently agitate for 20 min
- Discard the solution
Perform Washing procedure twice: - Add water and gently agitate for 20 s
- Discard the water
|
- Add staining solution and gently agitate for 20 min
- Discard the solution
Perform Washing procedure twice: - Add water and gently agitate for 20 s
- Discard the water
|
| 5. Developing |
- Add developing solution and gently agitate for ~4 min
- Discard the solution
|
- Add developing solution and gently agitate for 5-10 min
- Discard the solution
|
| 6. Terminating |
- Add stop solution and gently agitate for 5 min
- Discard the solution
|
- Add stop solution and gently agitate for 10 min
- Discard the solution
|
- Semi-dry Protein Transfer for Western Blotting
-
NoteWear gloves throughout the procedure to avoid contamination. Use 100 ml of each solution for mini gels (8x10 cm; 10x10 cm), for larger gels use enough of the solution to completely cover the gel/membrane/paper sheets in each step. Buffers Tris-glycine-methanol protein transfer buffer. Cool at 4°C before use.
| Component |
Amount |
Final concentration |
| 10X Tris-glycine buffer |
10 ml |
1X |
| Methanol |
10 ml |
10% (v/v) |
| Deionized water |
to 100 ml |
|
CAPS buffer for electrotransfer of proteins onto PVDF for N-terminal sequencing. Cool at 4°C before use.
| Component |
Amount |
Final concentration |
| 10X CAPS (100 mM, pH 11.0) |
10 ml |
10 mM |
| Methanol |
10 ml |
10% (v/v) |
| Deionized water |
to 100 ml |
|
10X CAPS (3-[cyclohexylamino]-1-propanesulfonic acid). Store at 4°C.
| Component |
Amount |
Final concentration |
| CAPS |
2.21 g |
100 mM |
| Deionized water |
to 90 ml |
|
2N NaOH
| titrate to pH 11.0 (~4 ml) |
|
|
| Deionized water |
to 100 ml |
|
Ponceau S staining solution (only freshly made staining solution should be used).
| Component |
Amount |
Final concentration |
| Ponceau S |
0.2 g |
0.2% (w/v) |
| Glacial acetic acid |
1 ml |
1% (v/v) |
| Deionized water |
to 100 ml |
|
Semi-dry Protein Transfer
- Presoak 2-4 pieces of blotting paper (cut to the size of the gel) in transfer buffer for 5 min.
- Cut a piece of nitrocellulose membrane to the size of the gel and equilibrate it in transfer buffer. If a PVDF membrane is used, incubate it in methanol for 2 min before equilibrating it in transfer buffer. Use CAPS buffer for N-terminal sequencing, Tris-glycine-methanol protein transfer buffer is suitable for all other applications.
- Carefully remove the stacking gel from the resolving gel. Soak the resolving gel in CAPS buffer for 5 min if this buffer is used. This step can be omitted if Tris-glycine-methanol protein transfer buffer is used.
- Assemble the transfer sandwich with the resolving gel on the anode (+) as shown in Figure below. Use one sheet of blotting paper or two pieces of filter paper on each side of the sandwich. Make sure all air bubbles are removed since they will affect the efficiency of the electroblotting.
- Electrotransfer proteins from the gel on the membrane for ~60 min at room temperature. Maintain the current at 0.8 mA per 1 cm2 of the gel area and limit the voltage to 15 V.
- When the transfer is complete, turn off the power and peel off the layers of the sandwich until you reach the membrane. Remove the membrane with forceps and rinse it in deionized water.
Monitoring the Protein Transfer The efficiency of electrotransfer can be monitored using prestained protein ladders (Spectra™ Multicolor Broad Range Protein Ladder, PageRuler™ Prestained Protein Ladder, PageRuler™ Plus Prestained Protein Ladder and Prestained Protein Molecular Weight Marker. The use of the DualColor™ Protein Loading Pack also allows for monitoring of Western blot protein transfer from gel to membrane. Alternatively, the extent of protein transfer can be determined by staining the polyacrylamide gel after the transfer or by staining the protein directly on the membrane. Proteins on PVDF membranes can be visualized with the PageBlue™ Protein Staining Solution, while Ponceau S, India Ink or Amido Black are recommended for nitrocellulose and PVDF membranes.
 Figure. Blotting with a semi-dry transfer unit.
- Staining PVDF Membrane with PageBlue™ Protein Staining Solution
-
Note PVDF membrane must be air-dried before staining.
- Add PageBlue™ Protein Staining Solution to cover the PVDF membrane. Agitate gently for 2 min.
- Wash with 30% ethanol with gentle agitation for 5 min.
To completely remove the stain, wash the membrane with the mixture of 30% acetonitrile and 20% ethanol for 5 min.
- Migration Patterns in Different Electrophoresis Conditions
- Migration of Spectra™ Multicolor Broad Range Protein Ladder, 213 KB
Migration of Spectra™ Multicolor High Range Protein Ladder, 164 KB Migration of Spectra™ Multicolor Low Range Protein Ladder, 161 KB Migration of PageRuler™ Plus Prestained Protein Ladder, 193 KB Migration of PageRuler™ Prestained Protein Ladder, 213 KB
- Staining of Small Proteins
Protein fixation with glutaraldehyde is required before staining the gel with Coomassie Brilliant Blue dye (PageBlue™ Protein Staining Solution, #R0571) or silver (PageSilver™ Silver Staining Kit, #K0681). NoteOther compounds commonly used for protein fixation (e.g., acetic acid, isopropanol, ethanol, TCA) are not suitable; proteins will wash away during staining procedure. Procedure - Add 100 ml of deionized or distilled water to the gel and wash for 1 min with gentle agitation. Discard the wash.
- Add 50 ml of freshly prepared 5% glutaraldehyde solution (gel should be covered completely). Fix with gentle agitation for 30 min. Discard the solution.
- Add 100 ml of deionized or distilled water to the gel and wash for 5 minutes with gentle agitation. Discard the wash. Repeat this step twice. The gel is now ready for staining.
For detailed staining protocols using Fermentas PageBlue™ Protein Staining Solution or PageSilver™ Silver Staining Kit, refer to the product manuals.
NoteProceed directly to the staining step in PageBlue™ Protein Staining Solution protocol and to sensitizing step in PageSilver ™ Silver Staining Kit protocol.
- SDS-PAGE for Small Proteins
- We recommend to use special electrophoresis conditions that improve the resolution of small peptides (1 to 20 kDa). The main differences compared to a conventional gel include:
- higher Tris concentration in gel buffer (0.75 M
instead of 0.375 M);
- pH of 8.45 for both stacking and resolving gels;
- higher acrylamide cross-linking in resolving gel (C= 5% instead of the usual ~3%);
- ethylene glycol is included in the resolving gel.
Reagents - Ethylene glycol
- Stock solutions of acrylamide/bisacrylamide 19:1 and 29:1
- 3 M Tris-HCl buffer containing 0.4% SDS, pH 8.45
- 40% ammonium persulfate (APS)
- TEMED
- 1X Tris-tricine-SDS Buffer (10X Buffer (#B48), diluted to 1X concentration prior to use)
Gel Preparation The protocol is sufficient for two 0.75 mm mini gels.
| Component | 5% Stacking gel (C=3.3%) | 18% Resolving gel (C=5%) |
|---|
| Ethylene glycol | – | 2.4 ml | | 3 M Tris-HCl buffer, pH 8.45 | 1 ml | 2 ml | | Acrylamide/bisacrylamide (40%) | 0.5 ml (29:1) | 3.6 ml (19:1) | | Deionized water | 2.5 ml | – | | 40 % APS | 4 μl | 8 μl | | TEMED (100 %) | 16 μl | 12 μl | | Final volume | ~4 ml | ~8 ml |
|---|
Note
For preparation of home-made acrylamide/bisacrylamide solutions use the formulas provided below:
%T = (AA(g) + BIS(g)) / mass of solution x 100 %C = BIS(g) / (AA(g) +BIS(g)) x 100
Procedure (for 0.75 mm minigel): - Pour 3.3 ml of the resolving gel solution between the glass plates with a pipette. Quickly but carefully apply 1.1 ml of the stacking gel solution. Avoid the formation of the bubbles.
NoteBecause of the difference in densities of the stacking and resolving gel solutions, they do not mix with each other; a sharp interface is obtained immediately after applying the stacking gel solution. - Insert the comb. Ensure that no air bubbles are left in the gels. Allow the gels to polymerize for 1 hour at room temperature.
NoteFor best results, keep the gel at 4°C overnight in a plastic bag with some electrophoresis running buffer (to avoid drying). Do not remove the combs. - Just prior to using the gel, remove the comb carefully. Place the gel into the electrophoresis tank, fill the tank (bottom and top reservoirs) with fresh 1X Tris-tricine-SDS buffer, making sure that the gel wells are covered with the buffer.
- Load the samples.
- Perform electrophoresis at 200 V for ~2 hours or until the dye front reaches the bottom of the gel.
- Disassemble the gel sandwich and proceed with gel staining or Western blot procedures.
DNA Electrophoresis
- General Recommendations for DNA Electrophoresis
- Use the same DNA loading dye (supplied with the DNA ladder/marker) for both the sample DNA and the ladder/marker DNA.
- If possible, always load equal volumes of the sample DNA and the ladder/marker DNA. The sample can be diluted with 1X DNA loading dye.
- Avoid high salt concentrations in the DNA samples as this may cause bands to shift during electrophoresis.
- Following electrophoresis, visualize DNA by staining in 0.5 µg/ml ethidium bromide solution or SYBR® Green I.
- Choose the gel percentage according to the tables below:
Table 1. Recommended Agarose Gels for Electrophoretic Separation of DNA Fragments.
| Agarose gel, % |
Range of effective separation, bp |
Approximate positions of tracking dyes, bp* |
| Bromophenol blue |
Xylene cyanol FF |
| TBE buffer |
TAE buffer |
TBE buffer |
TAE buffer |
| 0.5 |
2000-50000 |
750 |
1150 |
13000 |
16700 |
| 0.6 |
1000-20000 |
540 |
850 |
8820 |
11600 |
| 0.7 |
800-12000 |
410 |
660 |
6400 |
8500 |
| 0.8 |
800-10000 |
320 |
530 |
4830 |
6500 |
| 0.9 |
600-10000 |
260 |
440 |
3770 |
5140 |
| 1.0 |
400-8000 |
220 |
370 |
3030 |
4160 |
| 1.2 |
300-7000 |
160 |
275 |
2070 |
2890 |
| 1.5 |
200-3000 |
110 |
190 |
1300 |
1840 |
| 2.0 |
100-2000 |
65 |
120 |
710 |
1040 |
| 3.0 |
25-1000 |
30 |
60 |
300 |
460 |
| 4.0 |
10-500 |
18 |
40 |
170 |
260 |
| 5.0 |
10-300 |
12 |
27 |
105 |
165 |
Table 2. Recommended Polyacrylamide Gels for Electrophoretic Separation of DNA Fragments (1).
| Polyacrylamide gel (with BIS at 1:20), % (w/v) |
Range of effective separation* |
Approximate positions of tracking dyes* |
| Bromophenol blue |
Xylene cyanol FF |
| Denaturing gels |
| 4.0 |
100-500 b |
50 b |
230 b |
| 5.0 |
70-400 b |
35 b |
130 b |
| 6.0 |
40-300 b |
26 b |
105 b |
| 8.0 |
30-200 b |
19 b |
75 b |
| 10.0 |
20-100 b |
12 b |
55 b |
| 15.0 |
10-50 b |
10 b |
0 b |
| 20.0 |
5-30 b |
8 b |
28 b |
| 30.0 |
1-10 b |
6 b |
20 b |
| Non-denaturing gels |
| 3.5 |
100-1000 bp |
100 bp |
460 bp |
| 5.0 |
80-500 bp |
65 bp |
260 bp |
| 8.0 |
60-400 bp |
45 bp |
160 bp |
| 12.0 |
50-200 bp |
20 bp |
70 bp |
| 15.0 |
25-150 bp |
15 bp |
60 bp |
| 20.0 |
5-100 bp |
12 bp |
45 bp |
Note
* Positions of the tracking dyes can only be estimated approximately because the dye front migrates as wide band. The following guidelines are recommended:
- Only high purity agarose should be used. TopVision™ Agarose was used to prepare the gels.
- Only freshly prepared electrophoresis buffers should be used. The buffers were prepared from Fermentas 50X TAE Buffer and 10X TBE Buffer.
- Choose electrophoresis conditions according to the recommendations below:
| Size of the DNA | Voltage | Buffer |
| <1 kb | 5-10 V/cm | TBE |
| 1-5 kb | 4-10 V/cm | TAE or TBE |
| > 5 kb | 1-3 V/cm | TAE |
| Up to 10 kb, fast electrophoresis with Express DNA ladders | up to 23 V/cm | TAE |
- Recommendations for Accurate Gel Quantification
- Always use the same DNA loading dye (supplied with the DNA ladder/marker) for both the sample DNA and the ladder/marker DNA.
- Always compare the sample band with the ladder band of the closest size.
- If possible, adjust the concentration of the sample to approximately equalize it with the amount of DNA in the nearest band.
- dNTPs, oligonucleotides, genomic DNA, RNA, NTPs or buffer components can interfere with spectrophotometrical measurements and lead to inaccurate quantification of sample DNA. In these cases, it is best to rely on gel quantification data.
- For the most accurate quantification, use video-densitometry analysis.
Reference
- Sambrook, J., et al., Molecular Cloning. A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 12.89, 5.42, 2001.
- Preparation of DNA Ladders/Markers for Electrophoresis
- Table 1. Recommendations for loading the conventional formulation (supplied in TE buffer) DNA ladders/markers.
| Technical specifications |
Conventional formulation (supplied in TE buffer) DNA ladders/markers |
| GeneRuler™ DNA ladders |
Lambda DNA markers |
Phage & Plasmid DNA markers |
Markers for Genomic DNA Analysis |
| Supplied amount / number of applic. |
50 µg (100 µl) is sufficient for:
- 100 applic. on agarose gel
- 50 applic. on native PAGE
|
50 µg (100 µl) is sufficient for 100 applic. on agarose gel |
50 µg (100 µl) is sufficient for:
- 100 applic. on agarose gel
- 50 applic. on native PAGE
|
6 µg (30 µl) is sufficient for 120 applic. on agarose gel |
| Amount used per 1 mm width of a gel lane |
0.1 µg (0.2 µl) for agarose gel 0.2 µg (0.4 µl) for PAGE |
0.1 µg (0.2 µl) for agarose gel | 0.1 µg (0.2 µl) for agarose gel 0.2 µg (0.4 µl) for PAGE |
6 ng |
| Dilution |
Not needed |
Not needed |
Not needed |
Mix 1 µl (0.2 µg) of DNA marker with 39 µl of nuclease-free water |
| Heating |
Do not heat |
Heat at 65°C for 5 min; chill on ice for 3 min before use |
Do not heat |
Heat at 65°C for 5 min; chill on ice for 3 min before use |
| I. Loading on agarose gel: |
DNA ladder/marker loading dye Water, nuclease-free |
1 µl (0.5 µg) 2 µl 9 µl |
1 µl (0.5 µg) 2 µl 9 µl |
1 µl (0.5 µg) 2 µl 9 µl |
10 µl (50 ng) of diluted marker 1 µl |
| Mix gently and load on gel |
| II. Loading on polyacrylamide gel: |
DNA ladder/marker loading dye Water, nuclease-free |
2 µl (1 µg) 0.5 µl 0.5 µl |
Not recommended for PAGE |
2 µl (1 µg) 0.5 µl 0.5 µl |
Not recommended for PAGE |
| Mix gently and load on gel |
Table 2. Recommendations for loading ready-to-use DNA ladders/markers.
| Technical specifications |
DNA ladders/markers, ready-to-use |
GeneRuler™ & O'GeneRuler™ DNA ladders |
MassRuler™ DNA ladders |
FastRuler™ DNA ladders |
O'RangeRuler™ DNA ladders |
ZipRuler™ Express DNA ladders |
Lambda DNA markers |
Phage & Plasmid DNA markers |
| Supplied volume/number of applic. |
500 µl for 100 applic. |
2x500 µl for 50-200 applic. |
2x500 µl for 50-333 applic. |
500 µl for 100 applic. |
2x500 µl for 100-200 applic. |
500 µl for 100 applic. |
500 µl for 100 applic. |
| Heating |
Do not heat |
Heat at 65°C for 5 min; chill on ice for 3 min before use |
Do not heat |
| Mix gently and load on gel |
| Volume per 1 mm width of a gel lane |
1-2 µl |
variable |
variable |
1-2 µl |
1-2 µl |
1-2 µl |
1-2 µl |
- Preparation of DNA Samples for Conventional DNA Electrophoresis
- 6X DNA Loading Dye, 6X MassRuler™ DNA Loading Dye, 6X Orange DNA Loading Dye, 6X TriTrack™ DNA Loading Dye are all used according to below protocol:
- Add 1 volume of 6X DNA loading dye to 5 volumes of DNA sample.
- Mix well, spin down and load.
- Preparation of DNA Samples from Enzymatic Reaction Mixtures or with Samples Containing High Amounts of DNA Binding Proteins
- Use 6X DNA Loading Dye & SDS Solution to prevent the appearance of additional bands or gel shifts when analyzing:
- probes after DNA restriction digestions, ligation or dephosphorylation reactions,
- DNA samples with high amounts of DNA binding proteins,
- DNA molecules with cohesive ends,
- or to stop an enzymatic reaction during kinetic experiments.
To mix 6X DNA Loading Dye & SDS Solution with sample DNA:
- Add 1 volume of 6X DNA Loading Dye & SDS Solution to 5 volumes of DNA sample.
- Mix well.
- Heat at 65°C for 10 minutes.
- Chill on ice, spin down and load. 0
Note
The prepared sample can be stored at -20°C and reused for electrophoresis after several freeze-thaw cycles.
Figure. The effect of SDS on electrophoresis of DNA samples containing high amounts of DNA binding proteins.
M – GeneRuler™ DNA Ladder Mix
1 – 0.5 µg lambda DNA prepared for loading with 6X DNA Loading Dye
2 – 0.5 µg lambda DNA prepared for loading with 6X DNA Loading Dye & SDS Solution
3 – 0.5 µg lambda DNA digested with TsoI, probe prepared for loading with 6X DNA Loading Dye
4 – 0.5 µg lambda DNA digested with TsoI, probe prepared for loading with 6X DNA Loading Dye & SDS Solution
5 – 0.4 µg of the 2 fragment ligation mixture prior the addition of T4 DNA Ligase
6 – 0.4 µg of the 2 fragment ligation mixture after the ligation with T4 DNA Ligase, probe prepared for loading with 6X DNA Loading Dye
7 – 0.4 µg of the 2 fragment ligation mixture after the ligation with T4 DNA Ligase, probe prepared for loading with 6X DNA Loading Dye & SDS Solution
- Preparation of DNA Samples for Denaturing Polyacrylamide/Urea Gel Electrophoresis
-
NoteUse the same loading dye solution for the sample and the ladder DNA.
- Mix the DNA sample with an equal volume of 2X RNA Loading Dye.
- Heat at 95°C for 5 min.
- Chill the sample on ice for 3 min.
- Keep samples on ice while loading.
- Non-denaturing Agarose Gel Electrophoresis
-
Note
- Use a flask of at least three times larger volume than that of the solution to avoid boiling over.
- Use the same 1X electrophoresis buffer to prepare the gel and to run electrophoresis.
- Dilute 50X TAE Buffer or 10X TBE Buffer to a 1X concentration immediately before use.
- Use TBE buffer for analysis of DNA bands smaller than 1500 bp. For larger DNA, use TAE buffer.
- For intensified gel staining, add ethidium bromide to both the gel and the electrophoresis buffer at a final 0.5 µg/ml concentration. Alternatively, stain the gel after electrophoresis (see below).
Wear gloves when handling ethidium bromide.
- For reliable analysis of supercoiled/relaxed plasmid ethidium bromide should not be included in the electrophoresis buffer or gel. The gel should be stained only after electrophoresis is complete.
- Ethidium bromide and exposure to UV light may cause DNA alterations. Therefore, avoid UV exposure and do not stain DNA with ethidium bromide if the purified fragments will be used for cloning experiments.
- Weigh out the required amount of agarose (depending on the gel percentage) into an Erlenmeyer flask.
- Add the appropriate volume of either 1X TBE or 1X TAE buffer and swirl to mix.
- Weigh the flask with the solution.
For high percentage gels (3-5%): add an excess amount of distilled water to increase the weight by 10-20%.
- Boil the mixture in a microwave oven (at medium power) until the agarose melts completely; swirl the flask several times while boiling. To prepare the highest quality agarose gels of any percentage, an additional 3-5 min of boiling after completely melting the agarose is recommended. A significant amount of water evaporates during this procedure and therefore restoring of the initial weight (in step 5) is required to obtain the desired percentage gel.
- Weigh the flask again and if necessary, add hot distilled water to restore the initial weight.
For high percentage gels (3-5%): check (by weighing) that the excess 10-20% of water has evaporated and, if needed, continue boiling to remove any excess, or add hot distilled water to restore the initial weight.
Optional: for intensified gel staining add ethidium bromide to a final concentration of 0.5 µg/ml. Mix well and heat for 1 min without boiling.
- Cool the solution to 65-70°C. Pour carefully on a clean casting plate with an appropriate comb. If bubbles appear, push them carefully away to the sides with a pipette tip.
- Solidify the gel for approximately 30 min before use. Low percentage LM agarose gels need to be solidified at 4°C.
- Immerse the gel into the desired electrophoresis buffer. Load the samples onto the gel.
- Run electrophoresis at 5-7 V/cm until the bromophenol blue runs approximately two-thirds of the way down the gel.
- After electrophoresis the gel can be stained by immersing it into a 0.5 µg/ml ethidium bromide solution for 15-20 min, stained with SYBR® Green I or any other DNA staining technique.
Warning. Hot agarose solution should be handled very carefully.
- Alkaline Agarose Gel Electrophoresis
-
Note
- Double stranded DNA ladders are not recommended for denaturing electrophoresis as they may form an atypical pattern. However, these discrepancies are normally acceptable for analysis of cDNA or other ssDNA in alkaline gels.
- Use a flask of at least three times larger volume than that of the solution to avoid boiling over.
- Wear gloves when handling ethidium bromide.
- Weigh out the required amount of agarose (depending on the gel percentage) into an Erlenmeyer flask.
- Add the appropriate volume of the buffer (30 mM NaCl, 2 mM EDTA, pH 7.5) and swirl to mix.
- Weigh the flask with the solution.
For high percentage gels (3-5%): add an excess amount of distilled water to increase the weight by 10-20%.
- Boil the mixture in a microwave oven (at medium power) until the agarose melts completely; swirl the flask several times while boiling. To prepare the highest quality agarose gels of any percentage, an additional 3-5 min of boiling after completely melting the agarose is recommended. A significant amount of water evaporates during this procedure and therefore restoring of the initial weight (in step 5) is required to obtain the desired percentage gel.
- Weigh the flask again and if necessary, add hot distilled water to restore the initial weight.
For high percentage gels (3-5%): check (by weighing) that the excess 10-20% of water has evaporated and, if needed, continue boiling to remove any excess, or add hot distilled water to restore the initial weight.
- Cool the solution to 65-70°C. Pour carefully on a clean casting plate with an appropriate comb. If bubbles appear, push them carefully away to the sides with a pipette tip.
- Solidify the gel for approximately 30 min before use.
- Immerse the gel for at least one hour into the alkaline electrophoresis buffer (30 mM NaOH, 2 mM EDTA). Dilute 5 volumes of the DNA sample or ladder with one volume of 6X alkaline electrophoresis loading buffer (180 mM NaOH, 6 mM EDTA, 18% Ficoll 400, 0.05% bromcresol green).
- Heat samples and ladder at 70°C for 5 min, then chill on ice for 3 minutes. Load onto the gel.
- Run electrophoresis at 3 V/cm in alkaline electrophoresis buffer (30 mM NaOH, 2 mM EDTA) until the dye runs approximately two-thirds of the way down the gel.
After electrophoresis the gel should be immersed for 30 min in 100-300 ml of 0.5 M Tris-HCl buffer, pH 7.5 and later stained in a 0.5 µg/ml ethidium bromide solution for 30 min. If staining is not enough, the whole procedure can be repeated.
Warning. Hot agarose solution should be handled very carefully.
- Non-denaturing PAGE
- For a nondenaturing 5% polyacrylamide gel solution of 40 ml, mix the following:
| 10X TBE Buffer |
4 ml |
| 20% acrylamide/bisacrylamide |
10 ml |
| Deionized water |
26 ml |
Caution: acrylamide is a neurotoxin; always wear gloves, safety glasses, and a surgical mask when working with acrylamide powder.
- Vigorously agitate the solution for 1 min by magnetic stirring to ensure complete mixing.
- Add 48 µl of TEMED and swirl the flask to ensure that the solution is thoroughly mixed.
- Immediately add 240 µl of fresh 10% (w/v) APS and mix thoroughly.
- Pour the acrylamide between the gel plates and insert the comb.
Clamp the comb in place at the top of the gel to avoid separation of the gel from the plates as the acrylamide polymerizes. Allow the gel to polymerize for 30 min. Important note: polymerization begins as soon as APS is added to the mixture, so all subsequent steps must be performed quickly.
- After polymerization is complete, remove the comb and any bottom spacers from the gel. Wash the gel plates to clean any spilled acrylamide and be sure that the spacers are properly seated and clean. Fill the lower reservoir of the electrophoresis tank with 1X TBE buffer. Initially, place the gel into the lower tank at an angle to avoid the formation of air bubbles between the plates and the gel bottom. Clamp the gel plates to the top of the electrophoresis tank and fill the upper reservoir with 1X TBE so that the wells are covered.
- Pre-run and warm the gel for at least 30 min at 5 V/cm (constant voltage).
Load the recommended volume of the ladder, premixed with the appropriate electrophoresis loading dye solution. Use the same loading dye for the sample DNA.
- Run the gel at 5 V/cm, taking care to avoid excessive heating. Run the gel for the time indicated in the certificate of analysis of the ladder.
- Stain the gel in a 0.5 µg/ml ethidium bromide aqueous solution for about 30 min. Examine the gel under the UV light.
- Denaturing Polyacrylamide/Urea Gel Electrophoresis
-
NoteDouble stranded DNA ladders are not recommended for denaturing electrophoresis as they may form an atypical pattern. However these usual discrepancies are normally acceptable for analysis of cDNA or other ssDNA in denaturing PAGE.
- For a denaturing 10% polyacrylamide gel solution of 40 ml, mix the following:
| 10X TBE Buffer |
4 ml |
| 20% acrylamide/bisacrylamide |
10 ml |
| UREA |
19.2 g (to 8 M final concentration) |
Deionized water
| to 40 ml |
|
Caution: acrylamide is a neurotoxin; always wear gloves, safety glasses, and a surgical mask when working with acrylamide powder.
- Vigorously agitate the solution by magnetic stirring to ensure complete mixing and solving of UREA powder.
- Add 40 µl TEMED and swirl the flask to ensure thorough mixing.
- Immediately add 400 µl of fresh 10% (w/v) APS and mix thoroughly.
- Pour the acrylamide between the gel plates and insert the comb.
- Clamp the comb in place at the top of the gel to avoid separation of the gel from the plates as the acrylamide polymerizes. Allow the gel to polymerize for 30 min.
Important note: polymerization begins as soon as APS is added to the mixture, so all succeeding actions must be performed promptly.
- After polymerization is complete, remove the comb and any bottom spacers from the gel. Fill the lower reservoir of the electrophoresis tank with 1X TBE buffer. Initially, place the gel into the lower tank at an angle to avoid the formation of air bubbles between the plates and the gel bottom. Clamp the gel plates to the top of the electrophoresis tank and fill the upper reservoir with 1X TBE so that the wells are covered.
- Pre-run and warm the gel for at least 30 min at 5 V/cm (constant voltage).
Note Heat the gel (buffer) during the whole run at 60-70°C.
- Wash the wells with 1X TBE buffer to remove UREA and gel pieces.
- Load the samples.
- Run the gel at 6 V/cm till the lower dye front reaches the three thirds of the gel.
- Soak the gel for about 15 min in 1X TBE to remove the urea prior to staining.
- Stain the gel in a 0.5 µg/ml ethidium bromide aqueous solution for about 30 min.
- Examine the gel under the UV light.
RNA Electrophoresis
- General Recommendations for RNA Electrophoresis
- RNA ladders, as well as any RNA, are extremely sensitive to degradation by ribonucleases. Use only fresh electrophoresis buffers and freshly poured gels.
- Use clean electrophoresis chambers. For RNA gel analysis, avoid electrophoresis tanks used for DNA miniprep analysis since DNA minipreps may contain RNase A or T1.
- Use the same loading dye for samples and for RNA markers. 2X RNA Loading Dye is available separately and is provided with all RiboRuler™ RNA ladders. It contains ethidium bromide for RNA visualization on denaturing formaldehyde gels. If RNA fragments are separated on native agarose gels or on polyacrylamide/urea gels, additional staining with ethidium bromide is recommended.
- For native gels, add 0.5 µg/ml of ethidium bromide to the agarose gel and to the running buffer.
- Preparation of RNA Ladders for Electrophoresis
- For RiboRuler™ RNA ladders:
- Mix 1 volume of RNA ladder and 1 volume of the supplied 2X RNA Loading Dye.
- Heat at 70°C for 10 min.
- Chill on ice for 3 minutes and spin down prior to loading on a gel.
- Load 0.5 µl of the prepared ladder for every mm of gel lane width (4 µl / 8 mm lane).
For RiboRuler™ RNA ladders, ready-to-use: - Heat RNA ladders at 70°C for 10 min.
- Chill on ice for 3 minutes and spin down prior to loading on a gel.
- Load 0.5 µl of the ladder for every mm of gel lane width (4 µl / 8 mm lane).
NoteLadders prepared as described above are not suitable for glyoxal/DMSO agarose gel electrophoresis.
- Preparation of RNA Samples for Electrophoresis
- Mix 1 volume of the 2X RNA Loading Dye and 1 volume of the RNA sample.
- Heat at 70°C for 10 min.
- Chill on ice for 3 minutes and spin down prior to loading on a gel.
Note
RNA samples prepared as described above are not suitable for glyoxal/DMSO agarose gel electrophoresis.
- Non-denaturing Agarose Gel
- Use an Erlenmeyer flask of at least three times larger volume than that of the solution to avoid boiling over.
- Use the same 1X electrophoresis buffer to prepare the gel and to run electrophoresis.
- Dilute 50X TAE or 10X TBE buffers to a 1X concentration immediately before use.
- Use TBE buffer for analysis of RNA bands smaller than 1500 b. For larger RNA, use TAE buffer.
- Weigh out the required amount of agarose (depending on the gel %) into an Erlenmeyer flask.
- Add the appropriate volume of either 1X TBE or 1X TAE buffer and swirl to mix.
- Weigh the flask with the solution.
For high percentage gels (3-5%): add an excess amount of distilled water to increase the weight by 10-20%. - Boil the mixture in a microwave oven (at middle power) until the agarose melts completely; swirl the flask several times while boiling. To prepare the highest quality agarose gels of any percentage, an additional 3-5 min of boiling after completely melting the agarose is recommended. A significant amount of water evaporates during this procedure and therefore restoring of the initial weight (in step 5) is required to obtain the desired percentage gel.
- Weigh the flask again and if necessary, add hot distilled water to restore the initial weight.
For high percentage gels (3-5%): check (by weighing) that the excess 10-20% of water has evaporated and, if needed, continue boiling to remove any excess, or add hot distilled water to restore the initial weight. Optional. For intensified gel staining add ethidium bromide to a final concentration of 0.5 µg/ml. Mix well and heat for an 1 minute without boiling. - Cool the solution to 65-70°C. Pour carefully on a clean casting plate with an appropriate comb. If bubbles appear, push them carefully away to the sides with a pipette tip.
- Solidify the gel for approximately 30 min before use. Low percentage LM agarose gels can be solidified at 4°C.
- Immerse the gel into the desired electrophoresis buffer.
- Heat the RNA samples and ladder at 70°C for 10 min, then chill on ice for 3 min. Load onto the gel.
- Run electrophoresis at 5 V/cm until the bromophenol blue runs approximately two-thirds of the way down the gel.
After electrophoresis the gel can be stained by immersing it into a 0.5 µg/ml ethidium bromide solution for 20 min, stained with SYBR® Green II or any other RNA staining technique. Warning. Hot agarose solution should be handled very carefully.
- Denaturing Formaldehyde Gels in MOPS Buffer
- Freshly prepare 10X MOPS buffer: 0.4 M MOPS (pH 7.0), 0.1 M sodium acetate, 0.01 M EDTA (pH 8.0).
- Prepare 1% TopVision™ Agarose gel as follows:
- stir 1g of agarose powder in 72 ml of deionized water;
- melt the agarose, and then add 10 ml of 10X MOPS buffer and mix;
- when the agarose solution cools to 60°C, add 18 ml of fresh formaldehyde (37%) in a fume hood and mix thoroughly;
- pour the gel.
- Place the gel into an electrophoresis apparatus containing 1X MOPS buffer.
- Heat the RNA samples and ladder at 70°C for 10 min, and then chill on ice for 3 min.
- Load onto the gel.
NoteThere is no need to stain the gel as ethidium bromide present in 2X RNA Loading Dye is sufficient for visualization under UV light.
- Denaturing Glyoxal/DMSO Gels in Sodium Phosphate Buffer
- Prepare thick 1% TopVision™ Agarose gel in 0.01 M sodium phosphate buffer, pH 7.0.
- Place the gel into an electrophoresis apparatus with 0.01 M sodium phosphate buffer, pH 7.0.
- Prepare for loading 25 µl aliquots of the ladder/samples by adding:
| Glyoxal (40% solution) |
4.5 µl |
| DMSO |
12.5 µl |
| 0.1 M sodium phosphate buffer, pH 7.0 |
2.5 µl |
- Mix and add:
| RiboRuler™ RNA Ladder or RNA sample |
3 µl |
| 2X RNA Loading Dye |
1 µl |
| DEPC-treated Water |
to 25 µl |
- Incubate for 1 hour at 50°C and then cool down to room temperature.
- Load the samples on a gel.
- Run electrophoresis at 5 V/cm until the bromophenol blue runs approximately two-thirds of the way down the gel.
- Stain the gel in ethidium bromide solution (final concentration 0.5 µg/ml) in 0.5 M ammonium acetate for 15-30 min.
- Wash the gel in fresh 0.5 M ammonium acetate solution for 15-30 min.
- Denaturing Polyacrylamide/urea Gels in TBE Buffer
- Prepare 20 ml of a 5% polyacrylamide gel containing 7 M urea by adding:
| 47.5% acrylamide: 2.5% bis-acrylamide solution |
2 ml |
| 10 M urea |
14 ml |
| 10X TBE Buffer |
2 ml |
| 10% freshly prepared ammonium persulfate |
0.2 ml |
| Deionized water |
1.8 ml |
- Mix and add 10 µl TEMED. Mix again and pour the gel carefully avoiding the formation of air bubbles.
- Insert the comb into the acrylamide and allow the gel to polymerize for at least 1 hour.
- Fill the electrophoresis apparatus with 1X TBE buffer.
- Heat the RNA samples and ladder at 70°C for 10 min, and chill on ice for 3 min.
- Load onto the gel.
- Run electrophoresis at 8 V/cm for about 1 hour.
- Soak the gel for about 15 minutes in 1X TBE to remove urea prior to staining.
- Stain the gel in 0.5 µg/ml ethidium bromide in 1X TBE solution for 15 min.
Transfection
- General Considerations for Transfection
- I. DNA Quality Requirements.
DNA quality is critical for successful transfection. Endotoxin-contaminated DNA may result in inefficient transfection and cause unacceptably high cellular toxicity. For DNA an A260/A280 ratio of 1.8, or greater is recommended. II. Cell Density. The recommended confluency for adherent cells on the day of transfection is 50-70% and 70-90% for TurboFect™ reagents. Suspension cells should be plated at an optimal density ensuring their logarithmic growth at the time of transfection. III. Incubation Time. Transient transgene expression takes place within 2-72 hours after DNA transfection. The optimal time depends on the cell type, promoter strength and expression product, and has to be determined experimentally. The recommended incubation time of cells with TurboFect™/protein complexes is 2 hours. IV. Choice of Promoter. High transfection efficiency depends both on the transgene promoter and on the cell line used. The cytomegalovirus (CMV) promoter is commonly used for high gene expression in a variety of cell lines. Other promoters, such as those from simian virus (SV40) and from Rous sarcoma virus (RSV) can also be used. V. Transfection Reagent/Biomolecule Ratio. The amount of transfection reagent used in transfection depends on the amount of DNA, siRNA or protein and cells to be transfected. The ratios presented in the protocols are starting ratios and can be further optimized for the best results. VI. Transfection in the Presence of Serum. Nucleic acid transfection efficiency using Fermentas transfection reagents is consistently high in the presence of serum. The presence of serum may reduce protein transfection efficiency by up to 50%. Therefore, protein transfection in serum-free medium is recommended for best results. VII. Centrifugation. Gentle centrifugation of tissue culture plates for 5 minutes at 280 x g after addition of the polyplexes can improve transfection efficiency.
- In vitro DNA Transfection using TurboFect™ in vitro Transfection Reagent
- Reagents to be Supplied by the User: serum free DMEM, RPMI or other growth medium. The presence of antibiotics in the medium has no effect on transfection efficiency.
The protocol below is provided for 24-well plate. Quantities and volumes should be scaled up according to the number of cells/wells to be transfected (see Table below for scale-up ratios).
- In each well, seed ~5x104 adherent cells or ~5x105 suspension cells 24 h prior to transfection.
Note - The recommended confluency for adherent cells on the day of transfection is 50-70%.
- Suspension cells should be in logarithmic growth phase at the time of transfection.
- Dilute 1 µg of DNA in 100 µl of serum free DMEM or other growth medium.
- Add 2 µl of TurboFect™ to the diluted DNA and mix the solution by pipetting.
- Incubate 15-20 minutes at room temperature.
Note - Prepare immediately prior to transfection.
- We recommend starting with 1 µg of DNA and 2 µl of TurboFect™ per well in a 24-well plate (see Table below).
- Subsequent optimization may further increase transfection efficiency depending on the cell line and transgene used.
- Add 100 µl of the TurboFect™/DNA mixture drop-wise to each well. Do not remove the growth medium from the cells.
- Gently rock the plate to achieve even distribution of the complexes.
- Incubate at 37°C in a CO2 incubator.
- Analyze transgene expression 24-48 hours later.
For stable transfection cells should be grown in selective medium for 10-15 days. Plates can be centrifuged for 2-5 min at 200xg to facilitate sedimentation of cells to the bottom of the plate. Table. Scale-up ratios for transfection with TurboFect™ in vitro Transfection Reagent. | Tissue culture vessel | Growth area, cm2/well | Media, ml | Adherent cells to seed the day before transfection* | DNA, µg**(µl***) | Volume of TurboFect™ (µl)** | | Recommended | Range | | 96-well plate | 0.3 | 0.2 | 0.5-1.20 x 104 | 0.2 (20) | 0.4 | 0.3-0.6 | | 48-well plate | 0.7 | 0.5 | 1.0-3.0 x 104 | 0.5 (50) | 1.0 | 0.5-1.4 | | 24-well plate | 2.0 | 1.0 | 2.0-6.0 x 104 | 1.0 (100) | 2.0 | 1.0-2.8 | | 12-well plate | 4.0 | 2.0 | 0.4-1.2 x 105 | 2.0 (200) | 4.0 | 2.0-6.0 | | 6-well plate | 9.5 | 4.0 | 0.8-2.4 x 105 | 4.0 (400) | 6.0 | 4.0-8.0 | | 60 mm plate | 20.0 | 6.0 | 2.0-6.3 x 105 | 6.0 (600) | 12.0 | 8.0-16.0 | Note * These numbers were determined using HeLa cells. Actual value depends on the cell type. ** Amount of DNA and TurboFect™ in vitro Transfection Reagent used may require optimization. *** The volume of the DNA solution should represent 1/10 of the total volume of the culture medium.
- In vitro DNA Transfection using ExGen 500 in vitro Transfection Reagent
- Reagents to be Supplied by the User: sterile solution of 150 mM NaCl is required to dilute plasmid DNA.
The protocol below is provided for adherent cells in a 24-well plate. Quantities and volumes should be scaled up according to the number of cells/wells to be transfected (see Table below for scale-up ratios). (A) Preparation of cells. Plate ~5x104 adherent cells or ~5x105 suspension cells per well 24 h prior to transfection.
Note - The recommended confluency for adherent cells on the day of transfection is 50-70%.
(B) Preparation of the ExGen 500/DNA Complexes. Prepare immediately prior to transfection. - Dilute 1 µg of DNA in 100 µl of 150 mM NaCl. Vortex gently and centrifuge briefly.
- Add 3.3 µl of ExGen 500 to the diluted DNA (not the reverse order) and vortex the solution immediately for 10 seconds.
- Incubate for 10 minutes at room temperature.
Note - We recommend starting with 1 µg of DNA and 3.3 µl (6 equivalents) of ExGen 500 per well of 24-well plate.
- Subsequent optimization may further increase the transfection efficiency depending on the cell line and transgene.
(C) Transfection - Add 100 µl of the ExGen 500/DNA mixture to each well.
Generally, the volume of the ExGen 500/ DNA mixture represents 1/10 of the total volume of the culture medium. - Gently rock the plate to achieve even distribution of the complexes.
- Centrifuge culture vessel, if possible, for 5 min at 280 x g.
- Incubate at 37°C for 24-48 hours in a CO2 incubator and analyse transgene expression.
Note - The above incubation is designed for transfection without media change. If media change is preferred, incubate for 30 min (if centrifugation is possible) or for 3-4 hours (if centrifugation is not possible). Replace the media with the fresh complete growth media. Incubate for 24-48 hours.
- Transient expression of the transgene is monitored 24-48 hours post-transfection, while stable expression is monitored 10-15 days after transfection.
Table. Scale-up ratios for transfection of adherent cells. | Tissue culture vessel | Growth area, cm2/well | Adherent cells to seed the day before transfection* | Amount of DNA, µg**(µl***) | Volume of ExGen 500 (µl) at equivalents**** | | 5 | 6 | 7 | 8 | | 96-well plate | 0.3 | 0.5-1.20 x 104 | 0.3 (20) | 0.8 | 0.99 | 1.15 | 1.32 | | 48-well plate | 0.7 | 1.0-3.0 x 104 | 0.5 (50) | 1.37 | 1.65 | 1.92 | 2.19 | | 24-well plate | 2 | 2.0-6.0 x 104 | 1 (100) | 2.75 | 3.3 | 3.84 | 4.39 | | 12-well plate | 4 | 0.4-1.2 x 105 | 2 (100) | 5.5 | 6.6 | 7.68 | 8.78 | | 6-well plate | 9.5 | 0.8-2.4 x 105 | 3 (200) | 8.23 | 9.87 | 11.52 | 13.2 | | 35 mm plate | 8 | 0.8-2.4 x 105 | 3 (200) | 8.23 | 9.87 | 11.52 | 13.2 | | 60 mm plate | 20 | 2.0-6.3 x 105 | 5 (200) | 13.71 | 16.45 | 19.2 | 21.9 | Note * These numbers were determined using Cos-7 cells. Actual value depends on cell type. ** Amount of DNA and ExGen 500 used may require optimization. DNA quantity can range from 0.5 µg to 10 µg per 100,000 cells. Likewise, the ExGen 500/DNA ratio can range from 5 to 10 equivalents. *** The volume of the DNA solution should represent 1/10 of the total volume of the culture medium. **** One equivalent of ExGen 500 represents the amount of reagent required to neutralize negative charges of DNA phosphate groups. One µg of DNA contains 3 nmol of phosphate, and 1 µl of ExGen 500 contains 5.47 nmol of nitrogen residues.
| Number of equivalents = | µl of ExGen 500 x 5.47 µg of DNA x 3 |
- In vivo DNA Transfection using ExGen 500 in vivo Transfection Reagent
- Reagents to be Supplied by the User: sterile solution of 5% glucose (w/v) to dilute ExGen 500 and DNA.
- Dilute 10 µg of DNA in 50 µl of a sterile 5% glucose solution. Vortex gently and centrifuge briefly.
- Dilute 1.8 µl of ExGen 500 solution (6 equivalents) in 50 µl of sterile 5% glucose solution. Vortex gently and centrifuge briefly.
- Add the diluted ExGen 500 to the diluted DNA (in this order). Vortex the solution immediately and spin down briefly.
- Incubate for 10 minutes at room temperature.
- Perform injections.
- Monitor gene expression with the method most suitable for your studies.
Note - The A260/A280 ratio should be at least 1.8 for purified DNA. It is important to use endotoxin-free DNA (less than 0.1EU/1 µg DNA).
- The amount of DNA and maximum injection volume depend on the experimental animal and the route of administration (see Tables 1 and 2 below) as well as on the targeted tissue or organ and on the expression vector.
- To prevent precipitation of the ExGen 500/DNA complex, the final concentration of DNA in the injection mix should not exceed 0.5 µg/µl.
Table 1. Suggested amount of DNA and maximum injection volume. | Animal | Route of injection | Suggested amount of DNA, µg | Maximum injection volume, µl | Reference | | Adult mouse | intravenous injection | 25-125 | 400-600 | 1, 6, 7, 9 | | brain injection | 2.5 | 5 | 5 | | Newborn mouse | brain injection | 1 | 2 | 5 | | Nude mouse | intravenous injection | 50 | 200 | 8 | | subcutaneous tumor injection | 10 | 100 | 8 | | Adult rabbit | tracheal injection | 300-700 | 300-700 | 2, 4 | | Newborn rabbit | tracheal injection | 300 | 300 | 4 | | Adult rat | brain injection | 0.5 | 2 | 12 | | Tadpole | brain injection | 0.5-1 | 1 | 10 | Pekin Duck* | intravenous injection | 400** | 2000 | 3 | Note * 10 day old. ** 400 µg of fluorescein-labeled antisense oligodeoxynucleotides. Table 2. Scale-up ratios | Amount of DNA, µg | Volume of ExGen 500 (µl) at different equivalents | | 3 | 4 | 5 | 6 | 7 | 8 | 9 | | 1 | 0.09 | 0.12 | 0.15 | 0.18 | 0.21 | 0.24 | 0.27 | | 5 | 0.45 | 0.6 | 0.75 | 0.9 | 1.05 | 1.2 | 1.35 | | 10 | 0.9 | 1.2 | 1.5 | 1.8 | 2.1 | 2.4 | 2.7 | | 50 | 4.5 | 6 | 7.5 | 9 | 10.5 | 12 | 13.5 | References- Bragonzi, A., et al., Conese M., Comparison between cationic polymers and lipids in mediating systemic gene delivery to the lungs, Gene Ther., Dec, 6(12), 1995-2004,1999.
- Ferrari, S., et al., Polyethylenimine shows properties of interest for cystic fibrosis gene therapy, Biochim Biophys Acta, Oct 28, 1447(2-3), 219-25, 1999.
- Chemin, I., et al., Liver-directed gene transfer: a linear polyethlenimine derivative mediates highly efficient DNA delivery to primary hepatocytes in vitro and in vivo, J. Viral Hepat, Nov, 5(6), 369-75, 1998.
- Ferrari, S., et al., ExGen 500 is an efficient vector for gene delivery to lung epithelial cells in vitro and in vivo, Gene Ther., Oct, 4(10), 1100-6, 1997.
- Goula, D., et al., Size, diffusibility and transfection performance of linear PEI/DNA complexes in the mouse central nervous system, Gene Ther, May, 5(5), 712-7, 1998.
- Goula, D., et al., Rapid crossing of the pulmonary endothelial
barrier by polyethylenimine/DNA complexes, Gene Ther., Mar, 7(6), 499-504, 2000.
- Goula, D., et al., Polyethylenimine-based intravenous delivery of transgenes to mouse lung, Gene Ther., Sep,
5(9), 1291-5, 1998.
- Coll, J.L., et al., In vivo delivery to tumors of DNA complexed with linear polyethylenimine, Hum Gene Ther., Jul 1, 10(10), 1659-66, 1999.
- Zou, S.M., et al., Systemic linear polyethylenimine (L-PEI)-mediated gene delivery in the mouse, J. Gene Med, Mar-Apr, 2(2), 128-34, 2000.
- Ouatas, T., et al., T3-dependent physiological regulation of transcription in the Xenopus tadpole brain studied polyethylenimine based in vivo gene transfer, Int J Dev Biol., Nov;42(8), 1159-64, 1998.
- Boussif, O., et al., A versatile vector for gene and oligonucleotide transfer into cells in culture and in vivo: polyethylenimine, Proc Natl Acad Sci U S A, Aug 1, 92(16), 7297-301, 1995.
- Fabre, V., et al., Homeostatic regulation of serotonergic function by the serotonin transporter as revealed by nonviral gene transfer, J Neurosci., Jul 1, 20(13), 5065-75, 2000.
- Detection of the beta-galactosidase Reporter Gene in Transfected Eukaryotic Cells
- 10X PBS buffer (pH 7.4): 1.37 M NaCl, 0.27 M KCl, 1 M Na2HPO4, 0.02 M K2HPO4.
Fixation buffer (pH 7.4): 1X PBS buffer and 0.25% glutardialdehyde. Staining buffer, prepare immediately before use as follows:
| Stock solutions |
Volume per 10 ml staining buffer |
Final concentration |
| 1 M MgCl2 |
20 µl
| 2 mM |
| 0.5 M K4Fe(CN)63H2O |
100 µl |
5 mM |
| 0.5 M K3Fe(CN)6 |
100 µl |
5 mM |
| X-Gal Solution, ready-to-use |
500 µl |
1 mg/ml |
| 10X PBS buffer (pH 7.4) |
9.28 ml |
diluted 10-fold |
Staining procedure:
- Wash the cells twice with cold 1X PBS buffer. Adhered cells can be washed in the transfection plates, suspension cells should be pelleted before washing.
- Fix the cells with Fixation buffer for 10 minutes at room temperature while gently rocking the plate. Use 150 µl of the Fixation buffer for each well of a 24-well plate.
- Wash the cells twice with cold 1X PBS buffer.
- Stain the cells with freshly prepared Staining buffer for 2-20 hours at 37°C. Use 200 µl of Staining buffer for each well of a 24-well plate.
- Count dark blue cells.
- Protein Transfection using TurboFect™ Protein Transfection Reagent
- Reagents to be Supplied by the User: serum-free DMEM, RPMI or other growth medium.
Quantities and volumes should be scaled-up according to the number of cells/well to be transfected (see Table below). Subsequent optimization of the quantities of protein and transfection reagent may further increase the transfection efficiency. If toxicity is observed, optimize the transfection reaction by varying the quantities of Enhancer Solution, protein or transfection reagent used.
Note
- Reagents must be added in the order indicated.
- The TurboFect™/protein complexes should be prepared immediately prior to transfection.
- In a 24-well plate, seed ~5x104 adherent cells or ~1x105 suspension cells per well 24 h prior to transfection.
Note - The recommended confluency for adherent cells on the day of transfection is 70-90%.
- Suspension cells should be plated at an optimal density ensuring logarithmic growth at the time of transfection.
- Dilute 1 μg of protein in 100 μl of 0.15 M NaCl or serum-free growth medium.
- Add 1 μl of Enhancer Solution and mix the solution by vortexing or pipetting.
- Add 1 μl of TurboFect™ Protein Transfection Reagent and immediately mix the solution by vortexing or pipetting.
- Incubate 15-20 min at room temperature.
- Adherent cells: aspirate the growth medium. Suspension cells: centrifuge the cells at 200 x g for 5 min and aspirate the growth medium.
Optional. Wash the cells once with serum-free growth medium.
- Add 500 μl of serum-free growth medium to the cells.
Note - Transfection can be performed in growth medium containing serum. In this case, the complete removal of the medium is not required. Aspirate half of the volume used for cell plating. Please note that the presence of serum will result in up to a 50% decrease in transfection efficiency.
- Add 100 μl of the TurboFect™/protein complexes drop-wise to each well.
- Gently rock the plate to achieve an even distribution of complexes.
- Incubate for 2 h at 37°C in a CO2 incubator.
- Cells can be immediately used for subsequent experiments.
- If cells are not used immediately, add 500 μl of complete growth medium with 2X serum and incubate until analysis. If toxicity is observed during prolonged incubation, remove the medium containing the TurboFect™/protein complexes 2 hours after transfection and add 1 ml of complete growth medium.
Note - Prior to analysis, wash the cells thoroughly with serum-free growth medium (PBS or NaCl can also be used). This step removes undelivered protein.
Table 1. Scale-up ratios for transfection with TurboFect™ Protein Transfection Reagent.
| Tissue culture vessel | 24 h prior to transfection | Serum-free media, ml | Protein dilution buffer, ml | Protein, µg | TurboFect™ reagent, µl | Enhancer Solution, µl |
|---|
Growth area, cm2/well | Media, ml | Adherent cells to seed 24 h prior to transfection* | recom- mended | range** | recom- mended | range*** |
|---|
| 96-well plate | 0.3 | 0.2 | 0.5-1.2 x 104 | 0.1 | 20 | 0.25 | 0.2 | 0.15-0.3 | 0.2 | 0.1-0.8 | | 48-well plate | 0.7 | 0.5 | 1-3 x 104 | 0.25 | 50 | 0.5 | 0.5 | 0.25-0.7 | 0.5 | 0.25-2 | | 24-well plate | 2 | 1 | 2-6 x 104 | 0.5 | 100 | 1 | 1 | 0.5-1.4 | 1 | 0.5-4 | | 12-well plate | 4 | 2 | 0.4-1.2 x 105 | 1 | 200 | 2 | 2 | 1-3 | 2 | 1-8 | | 6-well plate | 9.5 | 4 | 0.8-2.4 x 105 | 2 | 400 | 4 | 4 | 2-6 | 4 | 2-16 | | 60 mm plate | 20 | 6 | 2-6.3 x 105 | 3 | 600 | 6 | 6 | 4-8 | 6 | 3-24 | Note* These numbers were determined using HeLa, Jurkat cells. Actual value depends on the cell type. Amount of protein, TurboFect™ Protein Transfection Reagent and Enhancer Solution may require optimization. TurboFect™ Protein Transfection Reagent and Enhancer Solution can be diluted up to 10 times in sterile H2O immediately before the experiment for accurate pipetting. ** For peptide transfection, double the indicated values. *** For optimization experiments.
- In vivo DNA Transfection using TurboFect™ in vivo Transfection Reagent
- Reagents to be Supplied by the User: sterile solution of 5% glucose (w/v).
Protocol
- Dilute 50 µg of DNA in 400 µl of a sterile 5% glucose solution. Vortex gently and centrifuge briefly.
- Add 6 μl of TurboFect™ in vivo Transfection Reagent and mix the solution by pipetting.
- Incubate for 15-20 min at room temperature.
- Perform injections.
- Monitor gene expression with the method most suitable for your studies.
Note
- The A260/A280 ratio should be at least 1.8 for purified DNA. It is important to use endotoxin-free DNA (less than 0.1EU/1 µg DNA).
- The amount of DNA and maximum injection volume depend on the experimental animal and the route of administration (see Tables 1 below) as well as on the targeted tissue or organ and on the expression vector.
Table 1. Suggested amount of DNA and maximum injection volume.
| Animal |
Route of injection |
Suggested amount of DNA, µg |
Maximum injection volume, µl |
Reference |
| Adult mouse |
intravenous injection |
25-125 |
400-600 |
1, 6, 7, 9 |
| brain injection |
2.5 |
5 |
5 |
| Newborn mouse |
brain injection |
1 |
2 |
5 |
| Nude mouse |
intravenous injection |
50 |
200 |
8 |
| subcutaneous tumor injection |
10 |
100 |
8 |
| Adult rabbit |
tracheal injection |
300-700 |
300-700 |
2, 4 |
| Newborn rabbit |
tracheal injection |
300 |
300 |
4 |
| Adult rat |
brain injection |
0.5 |
2 |
12 |
| Tadpole |
brain injection |
0.5-1 |
1 |
10 |
Pekin Duck* |
intravenous injection |
400** |
2000 |
3 |
Note
* 10 day old.
** 400 µg of fluorescein-labeled antisense oligodeoxynucleotides.
Table 2. Scale-up ratios
| Amount of DNA, µg |
Volume of TurboFect™ in vivo Transfection Reagent, µl |
| recommended |
range |
| 1 |
0.12 |
0.1-0.16 |
| 5 |
0.6 |
0.5-0.8 |
| 10 |
1.2 |
1-1.6 |
| 50 |
6 |
5-8 |
References- Bragonzi, A., et al., Conese M., Comparison between cationic
polymers and lipids in mediating systemic gene delivery to
the lungs, Gene Ther., Dec, 6(12), 1995-2004,1999.
- Ferrari, S., et al., Polyethylenimine shows properties of
interest for cystic fibrosis gene therapy, Biochim Biophys
Acta, Oct 28, 1447(2-3), 219-25, 1999.
- Chemin, I., et al., Liver-directed gene transfer: a linear
polyethlenimine derivative mediates highly efficient DNA
delivery to primary hepatocytes in vitro and in vivo, J. Viral
Hepat, Nov, 5(6), 369-75, 1998.
- Ferrari, S., et al., ExGen 500 is an efficient vector for gene
delivery to lung epithelial cells in vitro and in vivo, Gene
Ther., Oct, 4(10), 1100-6, 1997.
- Goula, D., et al., Size, diffusibility and transfection performance
of linear PEI/DNA complexes in the mouse central
nervous system, Gene Ther, May, 5(5), 712-7, 1998.
- Goula, D., et al., Rapid crossing of the pulmonary endothelial
barrier by polyethylenimine/DNA complexes, Gene
Ther., Mar, 7(6), 499-504, 2000.
- Goula, D., et al., Polyethylenimine-based intravenous
delivery of transgenes to mouse lung, Gene Ther., Sep,
5(9), 1291-5, 1998.
- Coll, J.L., et al., In vivo delivery to tumors of DNA complexed
with linear polyethylenimine, Hum Gene Ther., Jul
1, 10(10), 1659-66, 1999.
- Zou, S.M., et al., Systemic linear polyethylenimine (L-PEI)-
mediated gene delivery in the mouse, J. Gene Med,
Mar-Apr, 2(2), 128-34, 2000.
- Ouatas, T., et al., T3-dependent physiological regulation
of transcription in the Xenopus tadpole brain studied
polyethylenimine based in vivo gene transfer, Int J Dev
Biol., Nov;42(8), 1159-64, 1998.
- Boussif, O., et al., A versatile vector for gene and oligonucleotide
transfer into cells in culture and in vivo: polyethylenimine,
Proc Natl Acad Sci U S A, Aug 1, 92(16), 7297-301, 1995.
- Fabre, V., et al., Homeostatic regulation of serotonergic
function by the serotonin transporter as revealed by nonviral
gene transfer, J Neurosci., Jul 1, 20(13), 5065-75, 2000.
- siRNA Transfection using TurboFect™ siRNA Transfection Reagent
- Reagents to be Supplied by the User: 0.15 M NaCl, serum-free DMEM, RPMI or other serum-free medium.
The protocol below is provided for adherent and suspension cells in a 24-well plate using TurboFect™ siRNA Transfection Reagent (#R1401). Quantities and volumes should be scaled-up according to the number of cells/wells to be transfected (see Table 1). Subsequent optimization of the quantities of siRNA and transfection reagent may further increase the transfection efficiency and result in more efficient gene silencing. Protocol
- Seed ~5x104 adherent cells or ~1x105 suspension cells per well in 0.5 ml of growth medium 24 hours prior to transfection.
Note
The recommended confluency for adherent and suspension cells on the day of transfection is 70-90%.
- Dilute 3 pmol of siRNA in 100 μl of 0.15 M NaCl or other serum-free medium for a final siRNA concentration of 5 nM in the cell culture.
- Add 1 μl of TurboFect™ to the diluted siRNA and mix by pipetting.
- Incubate 15-20 minutes at room temperature.
NoteThe TurboFect™/siRNA complexes should be prepared immediately prior to transfection.
- Add 100 μl of the TurboFect™/siRNA mixture drop-wise to each well.
- Gently rock the plate to achieve an even distribution of the complexes.
- Incubate at 37°C in a CO2 incubator.
- Assay gene suppression 24-72 hours later.
Table. Recommended number of cells to plate 24 hours prior to transfection with TurboFect™ siRNA Transfection Reagent.
| Tissue culture vessel |
Growth area, cm2/well |
Media, ml |
Adherent (suspension) cells to seed the day before transfection* |
| 96-well plate |
0.3 | 0.1 |
0.5-1.20 x 104 (2.0 x 104) |
| 48-well plate |
0.7 | 0.25 |
1.0-3.0 x 104 (5.0 x 104) |
| 24-well plate |
2.0 |
0.5 |
2.0-6.0 x 104 (1.0 x 105) |
| 12-well plate |
4.0 |
1.0 |
0.4-1.2 x 105 (2.0 x 105) |
| 6-well plate |
9.5 |
2.0 |
0.8-2.4 x 105 (4.0 x 105) |
| 60 mm plate |
20.0 |
3.0 |
2.0-6.3 x 105 (1.0 x 106) |
Note
* These numbers were determined using NIH3T3 GFP expressing cell line. Actual value depends on the cell type.
Detection
- Histochemical Detection of GUS (beta-glucoronidase) (1)
- Staining buffer, prepare immediately before use as follows:
| Stock solutions |
Volume per 1 ml staining buffer |
Final concentration |
| Water, nuclease-free |
830 µl |
|
| 1 M sodium phosphate (pH 7.0) |
100 µl |
0.1 M |
| 0.5 M EDTA, pH 8.0 |
20 µl |
10 mM |
| 10% Triton X-100 |
10 µl |
0.1% (v/v) |
| 50 mM K3Fe(CN)6 |
20 µl |
1 mM |
| 0.1 M X-Gluc (50 mg/ml) in dimethylformamide |
20 µl |
2 mM |
Staining procedure for cells and tissues:
- Remove media from the cells or tissue.
- Immerse cells/tissue in fresh staining buffer.
- Incubate cells/tissue for 12-24 hours at 37°C.
- Remove the staining buffer.
- Wash with several changes of 50% ethanol (up to 12 hours per wash), until the cells/tissue clears.
- Count dark blue cells.
Reference
- Jefferson, R., Assaying chimeric genes in plants: the GUS gene fusion system, plant Mol Biol Rep, 5, 387-405, 1987.
- Protocol for Preparation of BCIP-T/NBT Substrate Solution
- Add the following components to 10 ml of the Alkaline Phosphatase (AP) buffer (100 mM Tris-HCl (pH 9.5), 100 mM NaCl and 10 mM MgCl2):
| BCIP-T (50 mg/ml in dimethylformamide) |
33 µl |
| NBT (75 mg/ml in 70%dimethylformamide) |
44 µl |
Note
- Avoid exposure to light.
- Prepare fresh developing solution and use within an hour.
- BCIP-T and NBT solutions in dimethylformamide do not freeze. They are stable for approximately 2 years when stored at -20°C in the dark.
Tailing
- Protocol for Tailing of DNA 3’-termini
- Prepare the following reaction mixture:
| 5X reaction buffer for Terminal Deoxynucleotidyl Transferase | 4 µl |
| DNA fragments | 1 pmol of 3'-ends |
(dATP or dTTP) or (dGTP or dCTP) | 130 pmol or 60 pmol |
| Terminal Deoxynucleotidyl Transferas | 1.5 µl (30u) |
| Water, nuclease-free | to 20 µl |
| Total volume | 20 µl |
- Incubate the mixture at 37°C for 15 min.
- Stop the reaction by heating at 70°C for 10 min or by the addition of 2 µl 0.5 M EDTA.
Note
- Under the conditions described above, 100-130 dA or dT residues, or 20-30 dC or dG residues can be added per 3'-OH end of DNA.
- The efficiency of the reaction depends upon the type of 3'-OH termini of the DNA fragments. 3'-overhang ends are tailed with higher efficiency than recessed or blunt ends.
Production of Single-stranded DNA
- Production of Single-stranded Circular DNA Molecules from Supercoiled Double-stranded Plasmids in vitro
- Add the following components to a reaction tube:
| Plasmid containing Bpu10I recognition sequence (20 µg) |
20-356 µl |
| 10X Buffer R |
40 µl |
| Nb.Bpu10I | 4 µl (20 u) |
| Water, nuclease-free |
to 400 µl |
- Vortex the tube and spin in a microcentrifuge for 3-5 seconds.
- Incubate at 37°C for 1 hour.
- Add Ѕ volume of phenol (200 µl) and Ѕ volume of chloroform/isoamyl alcohol (24:1) (200 µl), vortex for 10 seconds and centrifuge at 10,000 rpm for 5 minutes.
- Transfer the upper aqueous phase to a fresh tube and add 1 volume (400 µl) of chloroform/isoamyl alcohol (24:1). Vortex and centrifuge for 5 minutes.
- Repeat step 5 twice more.
- Transfer the upper aqueous phase to a fresh tube. Add 1/10 volume of 3 M sodium acetate and 2.5 volumes of ice-cold ethanol. Mix and incubate at -20°C for 1 hour.
- Centrifuge at 10,000 rpm for 10 minutes.
- Pour off the supernatant and carefully wash the pellet with 200 µl of 75% ice-cold ethanol. Dry the pellet.
- Dissolve DNA in 50 µl of water, nuclease-free.
- Treat with Exonuclease III by adding the following components:
| 10X reaction buffer for ExoIII |
25 µl |
| Exonuclease III |
6 µl (1200 u) |
| Water, nuclease-free |
169 µl |
- Mix and incubate at 30°C for 10 min. Stop the reaction by heating at 70°C for 10 min.
- Extract the reaction mixture with phenol/chloroform as described in steps 4-6, precipitate DNA as described in steps 7-9 and dissolve in 10-30 µl of deionized water. This solution should contain single-stranded DNA, suitable for DNA sequencing, site-specific mutagenesis, differential display, etc.
Cloning
- Cloning of Blunt-end or 3'-dA Tailed PCR Products using the CloneJET™ PCR Cloning Kit
- Protocol for efficient cloning of PCR products generated with any thermostable DNA polymerase using the CloneJET™ PCR Cloning Kit, in pdf (340 KB).
- Cloning of PCR Products with 3'-dA Overhangs using the InsTAclone™ PCR Cloning Kit
- Protocol for direct one-step cloning of PCR products with 3'-dA overhangs generated by Taq DNA Polymerase and other thermostable DNA polymerases which lack proofreading activity using the InsTAclone™ PCR Cloning Kit, in pdf (756 KB).
Purification of RNA
- Purification of RNA from various sources using the GeneJET™ RNA Purification Kit
- Protocol for fast and efficient purification of high quality RNA from whole blood, mammalian cell cultures, mammalian tissues, yeast and bacteria using the GeneJET™ RNA Purification Kit, in pdf (60 KB).
Direct PCR
- Animal Tissue Lysis and PCR
- Protocol for rapid extraction and amplification of genomic DNA from mouse tail and ear clips, animal tissues, human hair shafts or saliva, fish and insect tissues using the Fast Tissue-to-PCR Kit, in pdf (118 KB).
Removal of RNA from DNA
- Removal of RNA from DNA Solutions
- Add 15-20 u of RNase I per 1 µg of RNA. RNase I is ≥ 90% active within pH range 7.0-8.8 at salt concentration 100-200 mM. Incubation with RNase I can be performed simultaneously with the digestion of DNA by restriction endonucleases.
- Incubate at 37°C for 30 minutes.
- Purify DNA by spin column or phenol/chloroform extraction.
|
|